ID: 1160533307

View in Genome Browser
Species Human (GRCh38)
Location 18:79577775-79577797
Sequence AGTGTCCAGCTCCCCTGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160533303_1160533307 20 Left 1160533303 18:79577732-79577754 CCTCTCACTGGGTGGCAGTGGCT No data
Right 1160533307 18:79577775-79577797 AGTGTCCAGCTCCCCTGTCAAGG No data
1160533298_1160533307 29 Left 1160533298 18:79577723-79577745 CCCAGCCTTCCTCTCACTGGGTG No data
Right 1160533307 18:79577775-79577797 AGTGTCCAGCTCCCCTGTCAAGG No data
1160533301_1160533307 24 Left 1160533301 18:79577728-79577750 CCTTCCTCTCACTGGGTGGCAGT No data
Right 1160533307 18:79577775-79577797 AGTGTCCAGCTCCCCTGTCAAGG No data
1160533299_1160533307 28 Left 1160533299 18:79577724-79577746 CCAGCCTTCCTCTCACTGGGTGG No data
Right 1160533307 18:79577775-79577797 AGTGTCCAGCTCCCCTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160533307 Original CRISPR AGTGTCCAGCTCCCCTGTCA AGG Intergenic
No off target data available for this crispr