ID: 1160535897

View in Genome Browser
Species Human (GRCh38)
Location 18:79591187-79591209
Sequence AGCTGCTGCTGGAGAACGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160535897_1160535904 -8 Left 1160535897 18:79591187-79591209 CCCTCCGTTCTCCAGCAGCAGCT No data
Right 1160535904 18:79591202-79591224 CAGCAGCTGTGGGCCCACTTGGG No data
1160535897_1160535905 -7 Left 1160535897 18:79591187-79591209 CCCTCCGTTCTCCAGCAGCAGCT No data
Right 1160535905 18:79591203-79591225 AGCAGCTGTGGGCCCACTTGGGG No data
1160535897_1160535908 24 Left 1160535897 18:79591187-79591209 CCCTCCGTTCTCCAGCAGCAGCT No data
Right 1160535908 18:79591234-79591256 AATGAATGAGTGACAAACTGAGG No data
1160535897_1160535903 -9 Left 1160535897 18:79591187-79591209 CCCTCCGTTCTCCAGCAGCAGCT No data
Right 1160535903 18:79591201-79591223 GCAGCAGCTGTGGGCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160535897 Original CRISPR AGCTGCTGCTGGAGAACGGA GGG (reversed) Intergenic
No off target data available for this crispr