ID: 1160537630

View in Genome Browser
Species Human (GRCh38)
Location 18:79603574-79603596
Sequence ACTGCTTGTATTTCGCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160537630_1160537639 27 Left 1160537630 18:79603574-79603596 CCACAGAGCGAAATACAAGCAGT No data
Right 1160537639 18:79603624-79603646 CCTTCCCCAGGCAGGAGACCTGG No data
1160537630_1160537635 19 Left 1160537630 18:79603574-79603596 CCACAGAGCGAAATACAAGCAGT No data
Right 1160537635 18:79603616-79603638 CCAAAGCCCCTTCCCCAGGCAGG No data
1160537630_1160537633 15 Left 1160537630 18:79603574-79603596 CCACAGAGCGAAATACAAGCAGT No data
Right 1160537633 18:79603612-79603634 AATTCCAAAGCCCCTTCCCCAGG No data
1160537630_1160537640 30 Left 1160537630 18:79603574-79603596 CCACAGAGCGAAATACAAGCAGT No data
Right 1160537640 18:79603627-79603649 TCCCCAGGCAGGAGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160537630 Original CRISPR ACTGCTTGTATTTCGCTCTG TGG (reversed) Intergenic