ID: 1160537640

View in Genome Browser
Species Human (GRCh38)
Location 18:79603627-79603649
Sequence TCCCCAGGCAGGAGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160537632_1160537640 -3 Left 1160537632 18:79603607-79603629 CCTGCAATTCCAAAGCCCCTTCC No data
Right 1160537640 18:79603627-79603649 TCCCCAGGCAGGAGACCTGGAGG No data
1160537630_1160537640 30 Left 1160537630 18:79603574-79603596 CCACAGAGCGAAATACAAGCAGT No data
Right 1160537640 18:79603627-79603649 TCCCCAGGCAGGAGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160537640 Original CRISPR TCCCCAGGCAGGAGACCTGG AGG Intergenic