ID: 1160537667

View in Genome Browser
Species Human (GRCh38)
Location 18:79603706-79603728
Sequence GTTCTTGCTGGCGGGGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160537646_1160537667 28 Left 1160537646 18:79603655-79603677 CCACCTTCCTGCAGTGCCGCCCT No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537658_1160537667 0 Left 1160537658 18:79603683-79603705 CCCGCCCTGAGAGGGACTGCGGC No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537652_1160537667 8 Left 1160537652 18:79603675-79603697 CCTCCGCCCCCGCCCTGAGAGGG No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537655_1160537667 2 Left 1160537655 18:79603681-79603703 CCCCCGCCCTGAGAGGGACTGCG No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537654_1160537667 5 Left 1160537654 18:79603678-79603700 CCGCCCCCGCCCTGAGAGGGACT No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537660_1160537667 -4 Left 1160537660 18:79603687-79603709 CCCTGAGAGGGACTGCGGCGTTC No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537656_1160537667 1 Left 1160537656 18:79603682-79603704 CCCCGCCCTGAGAGGGACTGCGG No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537650_1160537667 9 Left 1160537650 18:79603674-79603696 CCCTCCGCCCCCGCCCTGAGAGG No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537649_1160537667 12 Left 1160537649 18:79603671-79603693 CCGCCCTCCGCCCCCGCCCTGAG No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537648_1160537667 21 Left 1160537648 18:79603662-79603684 CCTGCAGTGCCGCCCTCCGCCCC No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537647_1160537667 25 Left 1160537647 18:79603658-79603680 CCTTCCTGCAGTGCCGCCCTCCG No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537659_1160537667 -1 Left 1160537659 18:79603684-79603706 CCGCCCTGAGAGGGACTGCGGCG No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data
1160537661_1160537667 -5 Left 1160537661 18:79603688-79603710 CCTGAGAGGGACTGCGGCGTTCT No data
Right 1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160537667 Original CRISPR GTTCTTGCTGGCGGGGTCTT GGG Intergenic