ID: 1160537682

View in Genome Browser
Species Human (GRCh38)
Location 18:79603760-79603782
Sequence GCTCTTGCTGGCGGGGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160537671_1160537682 -7 Left 1160537671 18:79603744-79603766 CCCCTCCCAGGCCTGCGCTCTTG No data
Right 1160537682 18:79603760-79603782 GCTCTTGCTGGCGGGGTCTTGGG No data
1160537673_1160537682 -9 Left 1160537673 18:79603746-79603768 CCTCCCAGGCCTGCGCTCTTGCT No data
Right 1160537682 18:79603760-79603782 GCTCTTGCTGGCGGGGTCTTGGG No data
1160537672_1160537682 -8 Left 1160537672 18:79603745-79603767 CCCTCCCAGGCCTGCGCTCTTGC No data
Right 1160537682 18:79603760-79603782 GCTCTTGCTGGCGGGGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160537682 Original CRISPR GCTCTTGCTGGCGGGGTCTT GGG Intergenic