ID: 1160537792

View in Genome Browser
Species Human (GRCh38)
Location 18:79604199-79604221
Sequence GTGGCCTCACGCTGCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160537792_1160537794 -9 Left 1160537792 18:79604199-79604221 CCCAGAGGGCAGCGTGAGGCCAC No data
Right 1160537794 18:79604213-79604235 TGAGGCCACCACACCCACCCAGG No data
1160537792_1160537796 -4 Left 1160537792 18:79604199-79604221 CCCAGAGGGCAGCGTGAGGCCAC No data
Right 1160537796 18:79604218-79604240 CCACCACACCCACCCAGGTGAGG No data
1160537792_1160537798 3 Left 1160537792 18:79604199-79604221 CCCAGAGGGCAGCGTGAGGCCAC No data
Right 1160537798 18:79604225-79604247 ACCCACCCAGGTGAGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160537792 Original CRISPR GTGGCCTCACGCTGCCCTCT GGG (reversed) Intergenic
No off target data available for this crispr