ID: 1160537850

View in Genome Browser
Species Human (GRCh38)
Location 18:79604459-79604481
Sequence CTGCGTGCCCAGGGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160537850_1160537864 29 Left 1160537850 18:79604459-79604481 CCCTCTGCCCCCTGGGCACGCAG No data
Right 1160537864 18:79604511-79604533 GAATTCACATGACCGTCCTTCGG No data
1160537850_1160537856 -6 Left 1160537850 18:79604459-79604481 CCCTCTGCCCCCTGGGCACGCAG No data
Right 1160537856 18:79604476-79604498 ACGCAGCTGACTCCCCTGTATGG No data
1160537850_1160537857 -5 Left 1160537850 18:79604459-79604481 CCCTCTGCCCCCTGGGCACGCAG No data
Right 1160537857 18:79604477-79604499 CGCAGCTGACTCCCCTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160537850 Original CRISPR CTGCGTGCCCAGGGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr