ID: 1160538812

View in Genome Browser
Species Human (GRCh38)
Location 18:79609690-79609712
Sequence GCCACTGGTGTCCCCAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160538809_1160538812 3 Left 1160538809 18:79609664-79609686 CCAGTTCTAGAGATGCCTAGGCT No data
Right 1160538812 18:79609690-79609712 GCCACTGGTGTCCCCAGAAAAGG No data
1160538807_1160538812 22 Left 1160538807 18:79609645-79609667 CCTTTGCTGTGGTTTATGGCCAG No data
Right 1160538812 18:79609690-79609712 GCCACTGGTGTCCCCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160538812 Original CRISPR GCCACTGGTGTCCCCAGAAA AGG Intergenic
No off target data available for this crispr