ID: 1160539741

View in Genome Browser
Species Human (GRCh38)
Location 18:79614037-79614059
Sequence CTGTGAACAAAACTTCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160539741_1160539742 2 Left 1160539741 18:79614037-79614059 CCAATGGGAAGTTTTGTTCACAG No data
Right 1160539742 18:79614062-79614084 ATTTAACATTGAGAAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160539741 Original CRISPR CTGTGAACAAAACTTCCCAT TGG (reversed) Intergenic
No off target data available for this crispr