ID: 1160540522

View in Genome Browser
Species Human (GRCh38)
Location 18:79617803-79617825
Sequence CTGCTTGTCCGCGCGGGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160540522_1160540528 -5 Left 1160540522 18:79617803-79617825 CCCGACCCCGCGCGGACAAGCAG No data
Right 1160540528 18:79617821-79617843 AGCAGCTTCCCAGAGGCCTCAGG No data
1160540522_1160540533 11 Left 1160540522 18:79617803-79617825 CCCGACCCCGCGCGGACAAGCAG No data
Right 1160540533 18:79617837-79617859 CCTCAGGAAGCCCCGCCCGAGGG No data
1160540522_1160540531 10 Left 1160540522 18:79617803-79617825 CCCGACCCCGCGCGGACAAGCAG No data
Right 1160540531 18:79617836-79617858 GCCTCAGGAAGCCCCGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160540522 Original CRISPR CTGCTTGTCCGCGCGGGGTC GGG (reversed) Intergenic
No off target data available for this crispr