ID: 1160540653

View in Genome Browser
Species Human (GRCh38)
Location 18:79618376-79618398
Sequence TGAGCGAGGCCGGCTGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160540653_1160540661 -5 Left 1160540653 18:79618376-79618398 CCAACTCCAGCCGGCCTCGCTCA No data
Right 1160540661 18:79618394-79618416 GCTCATCACGCACTCCTGGGGGG No data
1160540653_1160540662 -4 Left 1160540653 18:79618376-79618398 CCAACTCCAGCCGGCCTCGCTCA No data
Right 1160540662 18:79618395-79618417 CTCATCACGCACTCCTGGGGGGG No data
1160540653_1160540659 -7 Left 1160540653 18:79618376-79618398 CCAACTCCAGCCGGCCTCGCTCA No data
Right 1160540659 18:79618392-79618414 TCGCTCATCACGCACTCCTGGGG No data
1160540653_1160540666 26 Left 1160540653 18:79618376-79618398 CCAACTCCAGCCGGCCTCGCTCA No data
Right 1160540666 18:79618425-79618447 ACGTCTCTTTACATGCTAACAGG No data
1160540653_1160540657 -9 Left 1160540653 18:79618376-79618398 CCAACTCCAGCCGGCCTCGCTCA No data
Right 1160540657 18:79618390-79618412 CCTCGCTCATCACGCACTCCTGG No data
1160540653_1160540658 -8 Left 1160540653 18:79618376-79618398 CCAACTCCAGCCGGCCTCGCTCA No data
Right 1160540658 18:79618391-79618413 CTCGCTCATCACGCACTCCTGGG No data
1160540653_1160540660 -6 Left 1160540653 18:79618376-79618398 CCAACTCCAGCCGGCCTCGCTCA No data
Right 1160540660 18:79618393-79618415 CGCTCATCACGCACTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160540653 Original CRISPR TGAGCGAGGCCGGCTGGAGT TGG (reversed) Intergenic
No off target data available for this crispr