ID: 1160540660

View in Genome Browser
Species Human (GRCh38)
Location 18:79618393-79618415
Sequence CGCTCATCACGCACTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160540653_1160540660 -6 Left 1160540653 18:79618376-79618398 CCAACTCCAGCCGGCCTCGCTCA No data
Right 1160540660 18:79618393-79618415 CGCTCATCACGCACTCCTGGGGG No data
1160540649_1160540660 13 Left 1160540649 18:79618357-79618379 CCTGGCAGCTGCCCTAGCGCCAA No data
Right 1160540660 18:79618393-79618415 CGCTCATCACGCACTCCTGGGGG No data
1160540648_1160540660 26 Left 1160540648 18:79618344-79618366 CCAACGCAAAGGGCCTGGCAGCT No data
Right 1160540660 18:79618393-79618415 CGCTCATCACGCACTCCTGGGGG No data
1160540652_1160540660 1 Left 1160540652 18:79618369-79618391 CCTAGCGCCAACTCCAGCCGGCC No data
Right 1160540660 18:79618393-79618415 CGCTCATCACGCACTCCTGGGGG No data
1160540651_1160540660 2 Left 1160540651 18:79618368-79618390 CCCTAGCGCCAACTCCAGCCGGC No data
Right 1160540660 18:79618393-79618415 CGCTCATCACGCACTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160540660 Original CRISPR CGCTCATCACGCACTCCTGG GGG Intergenic
No off target data available for this crispr