ID: 1160541580

View in Genome Browser
Species Human (GRCh38)
Location 18:79626916-79626938
Sequence AGGTGGGTGGAGAGCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160541580_1160541591 30 Left 1160541580 18:79626916-79626938 CCTCCAGAGCTCTCCACCCACCT No data
Right 1160541591 18:79626969-79626991 TAAGGACTCTGATGGACAGACGG No data
1160541580_1160541590 22 Left 1160541580 18:79626916-79626938 CCTCCAGAGCTCTCCACCCACCT No data
Right 1160541590 18:79626961-79626983 CCTGTGTTTAAGGACTCTGATGG No data
1160541580_1160541588 12 Left 1160541580 18:79626916-79626938 CCTCCAGAGCTCTCCACCCACCT No data
Right 1160541588 18:79626951-79626973 CCGAGAGCAGCCTGTGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160541580 Original CRISPR AGGTGGGTGGAGAGCTCTGG AGG (reversed) Intergenic