ID: 1160541762

View in Genome Browser
Species Human (GRCh38)
Location 18:79627767-79627789
Sequence CTCAGGCGGGGCGCTTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160541752_1160541762 1 Left 1160541752 18:79627743-79627765 CCCTGCAATGAGTCCTGCCCGAG No data
Right 1160541762 18:79627767-79627789 CTCAGGCGGGGCGCTTTCATGGG No data
1160541753_1160541762 0 Left 1160541753 18:79627744-79627766 CCTGCAATGAGTCCTGCCCGAGA No data
Right 1160541762 18:79627767-79627789 CTCAGGCGGGGCGCTTTCATGGG No data
1160541751_1160541762 11 Left 1160541751 18:79627733-79627755 CCGTGGCGCTCCCTGCAATGAGT No data
Right 1160541762 18:79627767-79627789 CTCAGGCGGGGCGCTTTCATGGG No data
1160541750_1160541762 23 Left 1160541750 18:79627721-79627743 CCGTGTCTCAGACCGTGGCGCTC No data
Right 1160541762 18:79627767-79627789 CTCAGGCGGGGCGCTTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160541762 Original CRISPR CTCAGGCGGGGCGCTTTCAT GGG Intergenic
No off target data available for this crispr