ID: 1160541799

View in Genome Browser
Species Human (GRCh38)
Location 18:79628002-79628024
Sequence GAGCTGCCCAGCGCCCGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160541790_1160541799 29 Left 1160541790 18:79627950-79627972 CCACTGACTTTAGTGCCACTGGA No data
Right 1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG No data
1160541793_1160541799 14 Left 1160541793 18:79627965-79627987 CCACTGGAGGGCTTGTGTAGATG No data
Right 1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160541799 Original CRISPR GAGCTGCCCAGCGCCCGCCA GGG Intergenic
No off target data available for this crispr