ID: 1160542776

View in Genome Browser
Species Human (GRCh38)
Location 18:79634283-79634305
Sequence GGTCACTGGGAGTGCTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160542776_1160542784 2 Left 1160542776 18:79634283-79634305 CCTGCACAGCACTCCCAGTGACC No data
Right 1160542784 18:79634308-79634330 AAGGGAAAAACCTGCCCCCCAGG No data
1160542776_1160542791 27 Left 1160542776 18:79634283-79634305 CCTGCACAGCACTCCCAGTGACC No data
Right 1160542791 18:79634333-79634355 ATGCCCTACAGTTCAGTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160542776 Original CRISPR GGTCACTGGGAGTGCTGTGC AGG (reversed) Intergenic
No off target data available for this crispr