ID: 1160542784

View in Genome Browser
Species Human (GRCh38)
Location 18:79634308-79634330
Sequence AAGGGAAAAACCTGCCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160542772_1160542784 26 Left 1160542772 18:79634259-79634281 CCAGTGGGTCCCCTTTGGAAGGA No data
Right 1160542784 18:79634308-79634330 AAGGGAAAAACCTGCCCCCCAGG No data
1160542776_1160542784 2 Left 1160542776 18:79634283-79634305 CCTGCACAGCACTCCCAGTGACC No data
Right 1160542784 18:79634308-79634330 AAGGGAAAAACCTGCCCCCCAGG No data
1160542774_1160542784 16 Left 1160542774 18:79634269-79634291 CCCTTTGGAAGGAGCCTGCACAG No data
Right 1160542784 18:79634308-79634330 AAGGGAAAAACCTGCCCCCCAGG No data
1160542773_1160542784 17 Left 1160542773 18:79634268-79634290 CCCCTTTGGAAGGAGCCTGCACA No data
Right 1160542784 18:79634308-79634330 AAGGGAAAAACCTGCCCCCCAGG No data
1160542775_1160542784 15 Left 1160542775 18:79634270-79634292 CCTTTGGAAGGAGCCTGCACAGC No data
Right 1160542784 18:79634308-79634330 AAGGGAAAAACCTGCCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160542784 Original CRISPR AAGGGAAAAACCTGCCCCCC AGG Intergenic
No off target data available for this crispr