ID: 1160542791

View in Genome Browser
Species Human (GRCh38)
Location 18:79634333-79634355
Sequence ATGCCCTACAGTTCAGTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160542785_1160542791 -8 Left 1160542785 18:79634318-79634340 CCTGCCCCCCAGGCAATGCCCTA No data
Right 1160542791 18:79634333-79634355 ATGCCCTACAGTTCAGTCCGAGG No data
1160542782_1160542791 5 Left 1160542782 18:79634305-79634327 CCCAAGGGAAAAACCTGCCCCCC No data
Right 1160542791 18:79634333-79634355 ATGCCCTACAGTTCAGTCCGAGG No data
1160542781_1160542791 6 Left 1160542781 18:79634304-79634326 CCCCAAGGGAAAAACCTGCCCCC No data
Right 1160542791 18:79634333-79634355 ATGCCCTACAGTTCAGTCCGAGG No data
1160542780_1160542791 13 Left 1160542780 18:79634297-79634319 CCAGTGACCCCAAGGGAAAAACC No data
Right 1160542791 18:79634333-79634355 ATGCCCTACAGTTCAGTCCGAGG No data
1160542776_1160542791 27 Left 1160542776 18:79634283-79634305 CCTGCACAGCACTCCCAGTGACC No data
Right 1160542791 18:79634333-79634355 ATGCCCTACAGTTCAGTCCGAGG No data
1160542779_1160542791 14 Left 1160542779 18:79634296-79634318 CCCAGTGACCCCAAGGGAAAAAC No data
Right 1160542791 18:79634333-79634355 ATGCCCTACAGTTCAGTCCGAGG No data
1160542783_1160542791 4 Left 1160542783 18:79634306-79634328 CCAAGGGAAAAACCTGCCCCCCA No data
Right 1160542791 18:79634333-79634355 ATGCCCTACAGTTCAGTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160542791 Original CRISPR ATGCCCTACAGTTCAGTCCG AGG Intergenic
No off target data available for this crispr