ID: 1160550898

View in Genome Browser
Species Human (GRCh38)
Location 18:79693202-79693224
Sequence GTGGTGACCGGGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 932
Summary {0: 1, 1: 0, 2: 5, 3: 85, 4: 841}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160550891_1160550898 0 Left 1160550891 18:79693179-79693201 CCTGGCAGTGTCTTTGAGCAGGT 0: 1
1: 0
2: 0
3: 18
4: 206
Right 1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG 0: 1
1: 0
2: 5
3: 85
4: 841
1160550888_1160550898 16 Left 1160550888 18:79693163-79693185 CCTGAGGCCTGTGAAGCCTGGCA 0: 1
1: 0
2: 3
3: 32
4: 296
Right 1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG 0: 1
1: 0
2: 5
3: 85
4: 841
1160550887_1160550898 17 Left 1160550887 18:79693162-79693184 CCCTGAGGCCTGTGAAGCCTGGC 0: 1
1: 0
2: 7
3: 24
4: 307
Right 1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG 0: 1
1: 0
2: 5
3: 85
4: 841
1160550889_1160550898 9 Left 1160550889 18:79693170-79693192 CCTGTGAAGCCTGGCAGTGTCTT 0: 1
1: 0
2: 2
3: 17
4: 203
Right 1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG 0: 1
1: 0
2: 5
3: 85
4: 841

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160550898 Original CRISPR GTGGTGACCGGGAGGGAGGA TGG Intronic
900182134 1:1315763-1315785 GTGGGGGCGGGGAGGGAGGGAGG + Intronic
900226169 1:1534555-1534577 CTGGTGACCCTGAGAGAGGAGGG + Exonic
900552060 1:3261772-3261794 GTGGGGACCAGGACGGAGGGCGG - Intronic
900601267 1:3503754-3503776 GTGGGGAGCGGGAGGAAGGGTGG + Intronic
900602174 1:3507629-3507651 CTGGAGACAGGGAGGCAGGAAGG + Intronic
900977733 1:6027495-6027517 GTGGTCACTGAGAGGCAGGATGG + Intronic
901188481 1:7389781-7389803 GTGGTGAGGCCGAGGGAGGAGGG + Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
901928551 1:12582762-12582784 CTGGTGAACGGGAGAGTGGACGG - Intronic
902055679 1:13598707-13598729 GCGCTGCACGGGAGGGAGGATGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902802577 1:18839567-18839589 GTGGCGTCTGGGAGGGAGGGAGG - Intergenic
902816536 1:18919489-18919511 GTGGGGAGGGGGCGGGAGGAGGG + Intronic
903148122 1:21388012-21388034 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
903173126 1:21565725-21565747 GTGGTGACGGAGAGGCAGGTGGG - Intronic
903329922 1:22592131-22592153 GTGGTGATGGTGAGGCAGGAGGG - Intronic
903331554 1:22599596-22599618 GTGGAGAGAGGGAGGGAGGGAGG + Intronic
903923621 1:26818099-26818121 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
904183912 1:28687732-28687754 ATAGAGACAGGGAGGGAGGATGG + Intronic
904297021 1:29526478-29526500 GTGGTGGCCTGGAGGGGAGAAGG - Intergenic
904696421 1:32334310-32334332 GTGGGGACAGGGAAGGAGGTAGG + Exonic
904762803 1:32817690-32817712 GTGAAGAGCGGGAGGGACGAGGG + Exonic
904775071 1:32901399-32901421 GGGGTGACGGGAAGGGAGGCCGG - Intronic
904795042 1:33052017-33052039 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
904988792 1:34574489-34574511 GTGGTTAGAGGGAGGGAGGATGG - Intergenic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905699388 1:39999981-40000003 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
905734778 1:40317368-40317390 GGGGTTGCCGGGAGGGAGGCCGG + Intronic
905753443 1:40486481-40486503 GTGGTGGGAGGGAGGGAGGGAGG - Intronic
905989345 1:42320202-42320224 GTGGTGAGCGTGGGGGAGGGGGG + Intronic
906269182 1:44460935-44460957 GTGCTGACAGGGAAGGGGGAAGG - Intronic
906520146 1:46461967-46461989 GAGGAGACCAGGAGGGAGGCAGG - Intergenic
906693889 1:47811243-47811265 GTGGTGAGGGGAAGGGAGGAGGG - Intronic
906838461 1:49109489-49109511 GTGGACACTGGGAGGAAGGAAGG - Intronic
907019722 1:51055142-51055164 GGGGAGAGAGGGAGGGAGGAAGG - Intergenic
907304965 1:53508354-53508376 GTAGTGAGCGGGAGGGTGGAGGG - Intronic
907453731 1:54562452-54562474 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
907468152 1:54653197-54653219 CTGGTGATCTGGAGGGAGGCTGG - Exonic
907490566 1:54806359-54806381 GTGGGGGCCGGCAGTGAGGAGGG + Intronic
908165297 1:61451552-61451574 GTGCTGAGCGGGAGTGGGGAGGG - Intronic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
910343859 1:86216091-86216113 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
911056826 1:93715930-93715952 GTGGTGACAGGGAGCAAGGATGG + Intronic
911710359 1:101064547-101064569 GTGGGGACGGGGAGGTGGGATGG + Intergenic
912298426 1:108489789-108489811 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
912569800 1:110613157-110613179 GAAGTGACAGGGAAGGAGGAAGG - Intronic
912652246 1:111449639-111449661 GGGGTGACAGGGAGGGGAGAAGG + Intronic
912703454 1:111895207-111895229 GTGAGGACGGAGAGGGAGGAGGG + Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913306140 1:117430217-117430239 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
914443198 1:147724813-147724835 GTGGTTACCAGGAGTGGGGAGGG - Intergenic
914824992 1:151133518-151133540 CTGCCGACCGAGAGGGAGGAGGG + Intronic
915040987 1:152968056-152968078 GTGGTGGGGGGGAGGGGGGAGGG + Intergenic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915135588 1:153728841-153728863 GCGGATACCGGGTGGGAGGACGG + Intronic
915215534 1:154338156-154338178 GTGGTGACTGGGCTGGATGAAGG + Intronic
915342681 1:155185004-155185026 GTGGTAGGCGGGAGGGAGCAGGG + Intronic
915472641 1:156135136-156135158 GTGGTGACTGGGAGGGGTGGAGG - Intronic
915939887 1:160112343-160112365 GGGGTGCCGGGGCGGGAGGAGGG + Intergenic
916620257 1:166489280-166489302 GTGGTTACAGGGAGGGAAGGGGG - Intergenic
916992661 1:170261000-170261022 GGGGTGGCGGGGAGGGGGGAGGG + Intergenic
917058146 1:171006472-171006494 GAGGTGTGGGGGAGGGAGGAAGG - Intronic
917376012 1:174350096-174350118 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
917737624 1:177934967-177934989 GTGGGGAGCAGTAGGGAGGAGGG - Intronic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918228687 1:182509676-182509698 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
918332344 1:183472371-183472393 GGGGGGAGGGGGAGGGAGGAGGG - Intronic
918447521 1:184630029-184630051 GTGGTGAGAAGGAGGGAGGGAGG + Intergenic
918924322 1:190761495-190761517 GTAGTGAAGGTGAGGGAGGATGG + Intergenic
919357874 1:196549004-196549026 GTGGGGTGGGGGAGGGAGGAGGG + Intronic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920308229 1:205032481-205032503 GGGGTGGTGGGGAGGGAGGATGG - Intergenic
920438596 1:205963898-205963920 GCAGTGACCAGGAGAGAGGAAGG + Intergenic
920839548 1:209542730-209542752 GTGGTGGGAGGGAGAGAGGAGGG - Intergenic
921088817 1:211823428-211823450 GTGGTGACAGGGAGGGAATAGGG - Intronic
921132225 1:212229689-212229711 GTGGGGAGAGGAAGGGAGGAGGG - Intergenic
921414224 1:214869720-214869742 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
921414246 1:214869769-214869791 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
921883825 1:220283716-220283738 GTGATGGTGGGGAGGGAGGAAGG - Intergenic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
923179519 1:231502790-231502812 GTGGAGGCTGGGAGGAAGGAAGG - Intergenic
923685514 1:236150774-236150796 GTAGTGACCAGCAGGGAGGCAGG + Intronic
923710864 1:236386901-236386923 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
923747426 1:236715305-236715327 GTGGTAACAGGGTGGGGGGAGGG - Intronic
923747833 1:236719090-236719112 ATGGTGAAAGGGAGGGAAGAAGG - Intronic
924124877 1:240840011-240840033 GTGGTAACAGTGAGGGTGGAGGG - Intronic
924141373 1:241027254-241027276 GTGGTGGCAGGGAGTGGGGAGGG + Intronic
924406637 1:243754749-243754771 GTGGTGTGTGGGAGGGGGGACGG - Intronic
924436667 1:244048855-244048877 GGGGGGGCCGGGAGGGAGGGGGG + Intergenic
1062915167 10:1238538-1238560 GTGAACACCGGGAGGGAGGGGGG - Intronic
1062915541 10:1239717-1239739 GTGAACACCGGGAGGGAGGGGGG - Intronic
1063096223 10:2911372-2911394 GTAGGGAGCGGGAGGCAGGAGGG + Intergenic
1063309694 10:4940612-4940634 GGGGTGAAGGGAAGGGAGGAAGG + Intronic
1063317596 10:5021489-5021511 GGGGTGAAGGGAAGGGAGGAAGG - Intronic
1063528204 10:6804288-6804310 GTGGGGTAGGGGAGGGAGGAGGG - Intergenic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1064663532 10:17629164-17629186 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1064963250 10:20989561-20989583 GAGAAGACAGGGAGGGAGGAGGG + Intronic
1065485309 10:26231205-26231227 TAGGAGACAGGGAGGGAGGAAGG + Intronic
1067015858 10:42755800-42755822 GTGGTGACAGGCAGGGAATATGG - Intergenic
1067799490 10:49349300-49349322 GAGGGAGCCGGGAGGGAGGAAGG + Intergenic
1067821129 10:49531800-49531822 GGGCTGAACGGGATGGAGGATGG - Intronic
1067853473 10:49769858-49769880 GGGGAGAGAGGGAGGGAGGAAGG + Intergenic
1068802240 10:61154701-61154723 GTGTTGACTGGTAGAGAGGAAGG - Intergenic
1069544822 10:69320335-69320357 GTGGGGACCGGGAGTGAGGTAGG + Intronic
1069550352 10:69360052-69360074 GGGGTGACCCGGAGGGAGCAGGG - Intronic
1069560865 10:69428394-69428416 GTGGTGACGGGTAGGGAGGCAGG - Intergenic
1069917327 10:71795710-71795732 GAGCTGACGGGGTGGGAGGAGGG - Intronic
1070304899 10:75234309-75234331 GAGGTGCCCGGGCGGGAGGCGGG + Intronic
1070321560 10:75358598-75358620 GTAGGGCTCGGGAGGGAGGAAGG - Intergenic
1070528923 10:77319251-77319273 GTGGTGATGGGGTGGGATGAGGG - Intronic
1070637107 10:78137831-78137853 GGGGAGACAGGGAGGGAGGGAGG - Intergenic
1070769861 10:79075931-79075953 GGGATGACTGGCAGGGAGGATGG + Intronic
1070787625 10:79171147-79171169 GTGGAAAACGGGAGGGAGCAGGG - Intronic
1070799225 10:79235288-79235310 GTGGTGAAAGGAAGGCAGGAAGG + Intronic
1070812716 10:79306349-79306371 GTGATGCCAGGCAGGGAGGAAGG + Intronic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071600375 10:86956007-86956029 CCGGTGGACGGGAGGGAGGAGGG - Intronic
1071600953 10:86958503-86958525 GTGGGGGCGGGGAGGGAGGGAGG - Intronic
1071966993 10:90861650-90861672 GTGGGCAGCGGGAGGGAAGAAGG - Intergenic
1072149982 10:92675373-92675395 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1072308977 10:94136214-94136236 GTGGTTACCGGGGATGAGGAAGG + Intronic
1072918054 10:99552180-99552202 GTGGTTACCGGGAATGGGGATGG + Intergenic
1073147789 10:101291996-101292018 GTGAGGACGGGGAGGGGGGAAGG - Intergenic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073386153 10:103129104-103129126 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1073391019 10:103176343-103176365 GTGGGGACAGGGAGGGAGGTAGG - Intronic
1073483370 10:103800990-103801012 GTGGTGAAGAGGCGGGAGGATGG - Intronic
1073521194 10:104131050-104131072 GAGGAGGCAGGGAGGGAGGAAGG + Intronic
1073630289 10:105141397-105141419 GTGGGGACAGAGAGGGTGGAGGG + Intronic
1074815677 10:117139696-117139718 GCGGCGAGCGGGTGGGAGGAAGG + Intergenic
1074856920 10:117480575-117480597 GTTGTGCCTAGGAGGGAGGATGG - Intergenic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1075147196 10:119892537-119892559 GCGGAGGCCGGGCGGGAGGATGG - Intronic
1075546188 10:123356621-123356643 CCGGTGACAGAGAGGGAGGATGG + Intergenic
1075634495 10:124021037-124021059 CAGGTGACCAGCAGGGAGGAAGG + Intronic
1075944445 10:126420034-126420056 GTGTTGAGGGGGTGGGAGGAGGG + Intergenic
1076353705 10:129837364-129837386 GGGGTGGCAGGGAGGGAGGGAGG - Exonic
1077024522 11:433317-433339 GTGGTGACCGGGATGGTGGTCGG + Exonic
1077103218 11:831188-831210 GTGGTGACCCGGCTGCAGGAAGG - Intronic
1077141403 11:1026471-1026493 GTGGGCACCTGGAGGGAGGCAGG + Exonic
1077187775 11:1243154-1243176 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077188111 11:1244501-1244523 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077188196 11:1244825-1244847 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077188731 11:1246925-1246947 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077189066 11:1248272-1248294 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077189151 11:1248596-1248618 GTGGTCCCCGGGACGGAGGAGGG - Exonic
1077189629 11:1250456-1250478 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077189720 11:1250795-1250817 GTGGTCCCCGGGATGGAGGAGGG - Exonic
1077211252 11:1371896-1371918 GAGGAGCCCGGGAGGGAGCAAGG + Intergenic
1077225085 11:1436139-1436161 GTGGGGCCGGGGAGGGAGGCGGG + Intronic
1077407899 11:2390874-2390896 GTGGAGCCCGGGAGGGAGGGAGG + Intronic
1077414816 11:2420125-2420147 GGGGTGACCGCCAGGGAGAAGGG - Intronic
1077424331 11:2467282-2467304 TTGGTGTCCGGCAGGGAGGCAGG + Intronic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1077529147 11:3087015-3087037 GAGGGGCCCGGGAGGGAGGAGGG - Intergenic
1078525149 11:12095046-12095068 TTGATGAAAGGGAGGGAGGAAGG + Intronic
1079039801 11:17050547-17050569 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1079135394 11:17773551-17773573 CTGGGGGCCGGGAGGGGGGAGGG + Intronic
1081428010 11:42946178-42946200 GGGGTGGGGGGGAGGGAGGAGGG + Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081784755 11:45738520-45738542 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1081831707 11:46120709-46120731 GGGGTGTGTGGGAGGGAGGAGGG - Intronic
1083403420 11:62440411-62440433 CTCGTGGCTGGGAGGGAGGAAGG - Intronic
1083458376 11:62794333-62794355 GTGGGCACCGGGCTGGAGGAAGG + Exonic
1083627512 11:64079117-64079139 GCGGTGGACGGGAGGGAGGGAGG + Intronic
1083790377 11:64980909-64980931 GTGGTGAAAGGGAGGAAGGAAGG - Intergenic
1083879128 11:65539680-65539702 GAGTTGGCCGGGAGCGAGGATGG - Intronic
1083886643 11:65576404-65576426 ATGGTGAGTGGGAGGGAGGCGGG + Exonic
1084020289 11:66413315-66413337 GTGGCGGCCGGGAGGGTGGCAGG + Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084742886 11:71150399-71150421 GGAGGGACAGGGAGGGAGGAAGG + Intronic
1084849590 11:71928310-71928332 GGAGTGGCCGAGAGGGAGGAGGG - Intronic
1084906775 11:72354597-72354619 GTGGTGGGAGGGAGGGAGGAAGG - Intronic
1085077441 11:73604002-73604024 ATTGAGACCGGGAGAGAGGAAGG + Intergenic
1085778310 11:79385848-79385870 GTGGTAACTTGGAGGGAGGAGGG - Intronic
1085787600 11:79468766-79468788 GTGGAGGGAGGGAGGGAGGAGGG + Intergenic
1086719905 11:90106897-90106919 GTTGTGGCATGGAGGGAGGAGGG + Intergenic
1087057320 11:93947304-93947326 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1087128414 11:94648161-94648183 GTGGTGTTGGTGAGGGAGGAGGG + Intergenic
1088884917 11:113998968-113998990 GGGGTGACGGGGAGGGAGAGGGG - Intergenic
1089018854 11:115190401-115190423 GTGGGGAAGGGCAGGGAGGAGGG - Intronic
1089169020 11:116499745-116499767 GTGCGCACAGGGAGGGAGGATGG - Intergenic
1089291289 11:117439214-117439236 GTGGGGACAGGGATGGAGAAAGG - Intronic
1089356181 11:117855522-117855544 GTGGTCACTGGGAGGGTGGGAGG - Intronic
1089532110 11:119136907-119136929 GTGGGCTCCTGGAGGGAGGAGGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090322979 11:125863196-125863218 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1090579995 11:128148986-128149008 GTGGGGACAGTGAGGGAGGCTGG + Intergenic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090791089 11:130091728-130091750 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1090900616 11:131027463-131027485 GTAGTGTCTTGGAGGGAGGAGGG + Intergenic
1091792623 12:3280504-3280526 GTGGGGCCAGGCAGGGAGGAGGG + Intronic
1091912728 12:4244931-4244953 GGGGTGATGGGGAAGGAGGAGGG - Intergenic
1091941149 12:4483703-4483725 GTGGTGATGGGGATGGGGGAGGG - Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1095068752 12:37814926-37814948 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1095137465 12:38622931-38622953 GGGGTGGGGGGGAGGGAGGAGGG + Intergenic
1095184357 12:39184689-39184711 GTGTTGAGGGGGATGGAGGATGG - Intergenic
1095253947 12:40011640-40011662 GAGGAGACGGGGAGGGAGGAAGG - Intronic
1095439513 12:42227776-42227798 GTGCTGTCCGGGAGGGAGGTGGG + Intronic
1095439534 12:42227825-42227847 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1095552085 12:43455060-43455082 GTGGTTACCAGGAGGTAGCAGGG - Intronic
1095709777 12:45275976-45275998 GTGCTGTCAAGGAGGGAGGAGGG - Intronic
1096022275 12:48333102-48333124 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1096633653 12:52945296-52945318 GGGGTGGGCTGGAGGGAGGAAGG - Intronic
1096648658 12:53051323-53051345 GTTCTGACCGTGGGGGAGGAGGG + Intronic
1096716106 12:53492744-53492766 GTGGGGGCGGGGAGGGAGGTTGG - Intronic
1097031841 12:56095366-56095388 GTGGTTACCTGGAGAGAAGAGGG + Intronic
1097036512 12:56128214-56128236 GTGATCCCCGGGATGGAGGAGGG - Intronic
1097126971 12:56783551-56783573 GTCCTGTCCGGGAGGGAGGTGGG - Intronic
1097127923 12:56789366-56789388 GTCCTGTCCGGGAGGGAGGTGGG - Intergenic
1097227715 12:57488344-57488366 GATGTGACTGGGAGGGAAGAAGG - Intronic
1097250679 12:57630967-57630989 TTGGTGCCAGGTAGGGAGGAGGG - Exonic
1098303392 12:69077572-69077594 GTGGTGACCGGGGCTGGGGATGG + Intergenic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1100260610 12:92929163-92929185 GAGGGGACCGGGAAGGAGGTCGG + Exonic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101822426 12:108194330-108194352 CTGGTGACCGGGAGGCTGTAAGG + Intronic
1102212306 12:111136357-111136379 GTGGTGCCTGGGAGAGAAGAGGG + Intronic
1102509209 12:113402859-113402881 GTTGTGCCCGGGGAGGAGGAGGG + Intronic
1102521282 12:113478744-113478766 GCGGACCCCGGGAGGGAGGAGGG + Intergenic
1102691270 12:114763015-114763037 GTGGGGGCAGGGAGGGTGGAAGG - Intergenic
1102995072 12:117342846-117342868 GTGGTGAAAGGGAGGAAGGAAGG + Intronic
1103072622 12:117957437-117957459 ATGGTGGCCAGGAAGGAGGATGG - Intronic
1103620397 12:122183719-122183741 CTGGAGACAGGGAGGCAGGATGG - Intronic
1103733572 12:123044220-123044242 GAGGTGACCAGGAGTGAGAAAGG - Intronic
1103743257 12:123105614-123105636 CTGGTTACCGGGAGGCATGAGGG + Intronic
1103937837 12:124485953-124485975 GTGGGGAGTGGGAGGGAGGTGGG - Intronic
1104191072 12:126482426-126482448 GAGGAGAGAGGGAGGGAGGAAGG - Intergenic
1104223211 12:126806249-126806271 GTGGTCACCAGGAGTGAGGAAGG - Intergenic
1104610158 12:130221071-130221093 GGGGTGAGGGGGAGGGAGGGAGG - Intergenic
1104789201 12:131471374-131471396 GTGGTGCAGGGGAGGCAGGACGG + Intergenic
1104833062 12:131767836-131767858 GTGGAGGGAGGGAGGGAGGAGGG + Intronic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105367773 13:19779359-19779381 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1105578586 13:21674295-21674317 GTGGTGCCCGGGAGGTGGGTCGG + Intronic
1106114626 13:26806396-26806418 TTGATGTCCGGGAGGGAGGTGGG - Intergenic
1106157806 13:27173432-27173454 GTGGTTAGCGGGATGGAGGCAGG - Intergenic
1106483813 13:30155709-30155731 GTGGTGCCCGGGTGGCAGGCTGG + Intergenic
1106497448 13:30293445-30293467 GTACTGACTGGGAGGGATGAAGG - Intronic
1106795030 13:33196502-33196524 GTGGTTTCTGGGAGGGAGGGTGG + Intronic
1108330324 13:49378391-49378413 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1108351397 13:49593129-49593151 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1108373438 13:49792588-49792610 GGGGAGAGCGGGAGGGGGGAGGG + Exonic
1108559297 13:51627277-51627299 GTGGTGAGCGGGAAGGGGCAGGG + Intronic
1109133262 13:58614470-58614492 GTGGAGTCCGGGTGGGAAGAAGG + Intergenic
1109587274 13:64423036-64423058 GTGGTGGGGGGGAGGGGGGAGGG - Intergenic
1110269378 13:73574932-73574954 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1110269400 13:73574981-73575003 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1110734799 13:78923974-78923996 GTGGGGTGCGGGAGGGGGGAGGG - Intergenic
1112344030 13:98576338-98576360 GTGGTGGCCGGGTTGGCGGAGGG - Intronic
1112559603 13:100501358-100501380 AGGGTGACGGGGTGGGAGGAGGG - Intronic
1112630030 13:101150253-101150275 GCGGGGAGCGGGAGGGAGTATGG + Intronic
1113108689 13:106798819-106798841 GTGTTTACTGGAAGGGAGGATGG + Intergenic
1113179788 13:107612091-107612113 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1113891258 13:113736758-113736780 GTGGTCACGGGGAGAGAAGATGG + Exonic
1113952695 13:114080594-114080616 ATGGTGACGGGGTGGCAGGAGGG + Intronic
1114092667 14:19303027-19303049 GTGGTGACAGGCAGGGAATATGG - Intergenic
1115006857 14:28496382-28496404 GTGGTGTGCAGGAGGGAGGTGGG + Intergenic
1115320765 14:32077170-32077192 CTGGTGGCGGGGAGGGAGGGAGG + Intronic
1115609737 14:35039158-35039180 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1115609759 14:35039207-35039229 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1116480440 14:45389397-45389419 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1117617282 14:57546432-57546454 GGGGGGACCAGAAGGGAGGAGGG + Intergenic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118907226 14:70031796-70031818 GTGGTGGCAGTGAGGGAGGTTGG + Intronic
1119049194 14:71349651-71349673 GTGGTTACCAGGAGCCAGGATGG + Intronic
1119236766 14:73026667-73026689 GTGGTGTCCGGGTGGAAGGAAGG - Intronic
1119296591 14:73537993-73538015 GTGGTGGTGGGGCGGGAGGAGGG - Intronic
1119984222 14:79117636-79117658 ATGGTGAGTGGGAGTGAGGAAGG + Intronic
1120166466 14:81206827-81206849 GTGGAGAGAGGGAGGGAGAAGGG - Intronic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1121001369 14:90454152-90454174 CTGGTACCCAGGAGGGAGGAGGG - Intergenic
1121253113 14:92513996-92514018 GTGGGGATCGCGAGGGAGGAGGG - Intronic
1121306720 14:92911703-92911725 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1122020240 14:98831912-98831934 GTGAAGACAGGGAGTGAGGATGG + Intergenic
1122117604 14:99535590-99535612 GTCGGGCCCAGGAGGGAGGAGGG + Intronic
1122159713 14:99774156-99774178 GGGGAGACAGGGAGGGAGGGAGG + Intronic
1122252922 14:100452978-100453000 GTGGTGCTGGGGAGAGAGGATGG + Intronic
1122363413 14:101180776-101180798 GGGGTGACCCAGAGGGAGCAGGG - Intergenic
1122623168 14:103071113-103071135 ATGGAGGCCGGGAGGGAGGGAGG + Intergenic
1122810103 14:104283506-104283528 CTGCTGCCCGGGAGGGCGGAGGG + Intergenic
1122931173 14:104933630-104933652 GAGGGGACCGGGAGGGCGGGAGG + Exonic
1122931212 14:104933733-104933755 GAGGGGACCGGGAGGGCGGGAGG + Exonic
1122931254 14:104933836-104933858 GAGGGGACCGGGAGGGCGGGAGG + Exonic
1122931283 14:104933903-104933925 GAGGGGACCGGGAGGGCGGGAGG + Exonic
1123587493 15:21772796-21772818 GGGGTGCCGGGGAGAGAGGAAGG + Intergenic
1123587501 15:21772817-21772839 GGGGTGCCGGGGAGAGAGGAAGG + Intergenic
1123587508 15:21772838-21772860 GGGGTGTCTGGGAGAGAGGAAGG + Intergenic
1123624131 15:22215361-22215383 GGGGTGCCGGGGAGAGAGGAAGG + Intergenic
1123624139 15:22215382-22215404 GGGGTGCCGGGGAGAGAGGAAGG + Intergenic
1123624146 15:22215403-22215425 GGGGTGTCTGGGAGAGAGGAAGG + Intergenic
1123942604 15:25223860-25223882 GTGGTGACGGGGAGGGCCAAGGG + Intergenic
1123989467 15:25672869-25672891 ATGGTGCCTGGGAGGGAGAAGGG + Intergenic
1125659229 15:41382634-41382656 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1125685071 15:41559163-41559185 GAAGGGAGCGGGAGGGAGGAGGG - Exonic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126710065 15:51445233-51445255 TTGGAGTCCGTGAGGGAGGAGGG - Intergenic
1126778508 15:52119304-52119326 GTGATGAGAGGGAGGGAGGAGGG + Exonic
1127073003 15:55303112-55303134 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1127488108 15:59437955-59437977 GTGGGAACGAGGAGGGAGGAGGG + Intronic
1128086726 15:64891781-64891803 GTGGGAACTGGGAGGGAGCAGGG + Intronic
1128241962 15:66107394-66107416 TTAGTGGCCAGGAGGGAGGAAGG + Intronic
1128647497 15:69388135-69388157 GCTTTGACAGGGAGGGAGGAGGG - Intronic
1128792341 15:70442475-70442497 GTGGTGCCCAGGAGAGACGATGG + Intergenic
1129451372 15:75652970-75652992 GTGGTGAGTGTGTGGGAGGAAGG + Intronic
1129538949 15:76335969-76335991 GTGGTGGAGGAGAGGGAGGAGGG + Intergenic
1129762026 15:78134748-78134770 GTGTTTGCTGGGAGGGAGGATGG + Intronic
1130118258 15:81024359-81024381 GTGCTGACAATGAGGGAGGAGGG + Intronic
1130340757 15:82998177-82998199 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1131001364 15:88941795-88941817 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1131075227 15:89491211-89491233 GAGGGGACAGGCAGGGAGGATGG - Intronic
1131520285 15:93109405-93109427 TTGGAGGCGGGGAGGGAGGACGG - Intergenic
1131916589 15:97272270-97272292 GAGGTGACAGGGAGAGAAGATGG - Intergenic
1132053021 15:98626250-98626272 GTGGGGACAGGGAGGCAGGATGG - Intergenic
1132357755 15:101185431-101185453 GTGTTCACAGGGAAGGAGGATGG - Intronic
1132497943 16:272707-272729 GGAGTGACCGGGAGTGAGCAGGG + Intronic
1132745177 16:1433484-1433506 GTGGTGGCCGCGAGGGACGGAGG - Intergenic
1132776809 16:1599401-1599423 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1132776831 16:1599450-1599472 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1132850807 16:2024099-2024121 GAGGTGGGCGGGAGGGAGTAGGG - Intergenic
1132973838 16:2701847-2701869 CTGGTGACCCGGAGGGAGGCAGG + Intronic
1133047866 16:3099170-3099192 GTGGTGAGTTGGAGGGAGGTCGG - Intronic
1133271569 16:4613201-4613223 GTGGAGACCAGGAGGGAAGCAGG + Intronic
1133297703 16:4762943-4762965 GTGGTGACAGGGAGAGACCATGG - Intronic
1133346736 16:5076083-5076105 GATGTGACAGGGAGGGAAGAAGG + Intronic
1134293166 16:12920171-12920193 GTGGGTACGGGGAGGGGGGAGGG + Intronic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1134439106 16:14286932-14286954 GAGGTGACAGGGAGAGAGGGAGG + Intergenic
1135424103 16:22323865-22323887 GGGGTGACTGGGAGAGAGAAGGG - Intronic
1135728194 16:24873232-24873254 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136073532 16:27803146-27803168 GTGAGGACCGGGGGAGAGGAGGG - Intronic
1136609687 16:31358699-31358721 GGGGTGACATTGAGGGAGGAAGG + Intronic
1137641216 16:50031857-50031879 GTGTTGCCATGGAGGGAGGAAGG + Intronic
1137688482 16:50403164-50403186 ATGGTGAGAAGGAGGGAGGAAGG + Intergenic
1137915614 16:52426744-52426766 GTGGAGACTGGGATGGATGAGGG + Intergenic
1137979627 16:53058592-53058614 GTGGTGAAAGGGAGAGAGGCTGG + Intronic
1138529643 16:57628154-57628176 GTGCTGACCGGCAGAGCGGAAGG - Intronic
1138656079 16:58492257-58492279 GTGGTGTGTGGGAGGCAGGATGG - Intronic
1138658882 16:58506480-58506502 GTGGTGACCGGGGGTGGGGTGGG + Intronic
1139282645 16:65783907-65783929 GTGGAGGCCCGGAGAGAGGAAGG - Intergenic
1139754552 16:69132295-69132317 GGGGTGGCCGGGAAGGGGGAGGG - Intronic
1140108630 16:71984005-71984027 AGGGTGACTGGGAGGGAAGAAGG - Intronic
1140252353 16:73305172-73305194 GGGGTGGCCAGGTGGGAGGAAGG + Intergenic
1140771271 16:78205985-78206007 ATGGAGACAGGAAGGGAGGAAGG - Intronic
1140924720 16:79571231-79571253 GGGATGAGCGGGAGGGAGGAAGG + Intergenic
1141025229 16:80540807-80540829 GTGGGTCCCGGGAGGGAAGAGGG - Intronic
1141527054 16:84618290-84618312 GAAGAGAGCGGGAGGGAGGAGGG - Intergenic
1141693009 16:85607066-85607088 GGGGGGGGCGGGAGGGAGGAGGG + Intergenic
1141694098 16:85611856-85611878 GCGGGGAGGGGGAGGGAGGAAGG + Intronic
1141747514 16:85935711-85935733 GTTGTGAGAGGGAGGCAGGAGGG + Intergenic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1141860358 16:86712270-86712292 AGGGTGCTCGGGAGGGAGGAGGG - Intergenic
1142389844 16:89792134-89792156 GTGGCCACCGGCTGGGAGGAAGG - Intronic
1142419382 16:89961100-89961122 GTGGTGGCAGGGAGAGAAGAGGG + Intronic
1142560012 17:804232-804254 GTGGTGAGCGGGAGGGGGTGAGG + Intronic
1144161689 17:12566447-12566469 GTAGTGAGAGGGAGGGAGCAAGG - Intergenic
1144482000 17:15637199-15637221 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1144666993 17:17108688-17108710 GGGGTGACCGGGAGGGTGCTGGG + Intronic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1145047207 17:19627903-19627925 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1146935657 17:36811176-36811198 GTGGGGAGCAGGAGGGAGGGAGG - Intergenic
1146956431 17:36938762-36938784 GTAGTGGCCGGGAGGGAGCCTGG - Intronic
1147151365 17:38516483-38516505 AGGGTGAGAGGGAGGGAGGAAGG + Intergenic
1147723635 17:42553588-42553610 TTGGTGACCGGGAGCGTGGGAGG + Exonic
1147725760 17:42565309-42565331 AGGGTGAGTGGGAGGGAGGATGG + Exonic
1147963395 17:44180681-44180703 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1148232766 17:45947221-45947243 GTGGTGGGCAGGAGAGAGGAGGG + Intronic
1148236329 17:45971676-45971698 GTGTTGGCAGGGAGGGAGGTGGG + Intronic
1149531045 17:57395543-57395565 GTTGTGAGGGTGAGGGAGGATGG + Intronic
1149908926 17:60551502-60551524 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1149993867 17:61396998-61397020 GAGGTGACGGGGCCGGAGGACGG + Intergenic
1150462424 17:65363910-65363932 GTGGTGGGGGAGAGGGAGGAGGG - Intergenic
1150656836 17:67044899-67044921 GTGGGGATCGGGACGGAGGGTGG - Intronic
1151190234 17:72392954-72392976 GGGATGCCTGGGAGGGAGGAAGG - Intergenic
1151201402 17:72470445-72470467 GTGGTGACTGGGTGGGGAGAAGG - Intergenic
1151247252 17:72804394-72804416 GTGGGGAGTGGGAGGGAAGAGGG - Intronic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1151681367 17:75624501-75624523 GTGATGAGGGGGAGGGAGGCTGG - Intergenic
1151699997 17:75737814-75737836 GTGGGGACCGTGGTGGAGGATGG - Intronic
1152148917 17:78586812-78586834 GTGGTGACCTGAAGGGAGTTGGG + Intergenic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152311533 17:79554292-79554314 GGGGTGACTGTGAGTGAGGATGG - Intergenic
1152311542 17:79554329-79554351 GGGGTGACTGTGAGTGAGGATGG - Intergenic
1152311551 17:79554366-79554388 GGGGTGACTGTGAGTGAGGATGG - Intergenic
1152311560 17:79554403-79554425 GGGGTGACTGTGAGTGAGGATGG - Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152596345 17:81239499-81239521 GAGGTGGCTGGGAGGGAGGACGG + Intronic
1152753624 17:82077855-82077877 GTGGAGGCTGGGAGGGAGCAAGG - Intergenic
1152803634 17:82344169-82344191 GTGGAGACAGGGAGGCAGGGGGG + Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153161563 18:2210401-2210423 GTGGTGGGGGGGAGGGGGGAGGG + Intergenic
1153556691 18:6322420-6322442 ATGGAGGCAGGGAGGGAGGAAGG + Intronic
1153855022 18:9136987-9137009 GTGGCGACAGGAAAGGAGGAAGG + Intronic
1153953544 18:10076783-10076805 GAGGTGACCGGTGGGCAGGATGG - Intergenic
1154238283 18:12627203-12627225 GTGGGGTGGGGGAGGGAGGAGGG - Intronic
1154333403 18:13447981-13448003 GGGGTGGCCGGGAGGGTGTAGGG + Intronic
1155392695 18:25352208-25352230 GCGGGGAGCGGGAGGGAGGAGGG + Intergenic
1156289089 18:35729738-35729760 GAGGTGAGAGGGAGGGAGGGAGG + Intergenic
1156738353 18:40292256-40292278 GGGGGGATGGGGAGGGAGGAAGG - Intergenic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157639931 18:49203031-49203053 GTGCCGTCCGGGAGGGAGGTTGG + Intronic
1157677190 18:49577655-49577677 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1157677335 18:49577980-49578002 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1157724418 18:49952938-49952960 GAGGTGACAGGAAGAGAGGACGG - Intronic
1158058715 18:53312965-53312987 GTGGGGAGAGGAAGGGAGGAGGG + Intronic
1158245144 18:55423894-55423916 GTGGTGACTGGGCGGAAGGGGGG + Intronic
1158435873 18:57435483-57435505 GAGGGGACGGGGAGGGAGGGAGG - Intergenic
1158447571 18:57534448-57534470 GTGTAGACTGGGTGGGAGGAGGG - Intergenic
1158898743 18:61940995-61941017 GTGGTGAGAGAGAGAGAGGAAGG + Intergenic
1160139402 18:76307626-76307648 TTGCTGACTGGGAGGAAGGATGG - Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1160583014 18:79898428-79898450 GTGGGGACTGGGCAGGAGGAGGG + Intronic
1160674138 19:379847-379869 GCTGTGACTGGGAGGGAGGTGGG + Intergenic
1160674925 19:384945-384967 GCTGTGACCGGGAGGGAGGTGGG + Intergenic
1160674938 19:384987-385009 GCTGTGACTGGGAGGGAGGTGGG + Intergenic
1160674950 19:385029-385051 GCTGTGACTGGGAGGGAGGTGGG + Intergenic
1160676392 19:393616-393638 GTGGTGATGGGGAAGGATGATGG + Intergenic
1160676437 19:393793-393815 GTGGTGATGGGGAAGGATGATGG + Intergenic
1160676471 19:393948-393970 GTGGTGATGGGGAAGGATGATGG + Intergenic
1160758624 19:771638-771660 GGGGAGATAGGGAGGGAGGAGGG - Intergenic
1160797088 19:950565-950587 GTGGGGACCGGCAGGCAGGCAGG + Intronic
1160812158 19:1017540-1017562 GGGCTGACCCGGAGGAAGGAAGG - Intronic
1160963918 19:1737253-1737275 ATGGCGACGGGGAGGCAGGAAGG + Intergenic
1160970403 19:1765364-1765386 CTGCTGGCTGGGAGGGAGGATGG - Intronic
1161046102 19:2135880-2135902 GTGGTAACTGGGAGGGAGGAGGG - Intronic
1161078598 19:2299214-2299236 GTGCTGCCGGGGAGGCAGGAGGG + Intronic
1161226660 19:3150114-3150136 GTGGTGCTGGGGAGGGAGGACGG - Exonic
1161241364 19:3225392-3225414 GTGGGGTGAGGGAGGGAGGAAGG - Intronic
1161256020 19:3310141-3310163 ATGGAGACAGGGAGGGAGGGAGG - Intergenic
1161298886 19:3533279-3533301 GTGCTCACCTGGAGGGCGGAGGG - Exonic
1161325775 19:3663305-3663327 GAGGTGGCAGGGAGGGAGGTCGG + Intronic
1161359693 19:3840925-3840947 GTGGTGACCGGGGGCCAGCATGG + Intronic
1161591705 19:5131949-5131971 GTGGGGACCGGGTGGGCGGCCGG - Exonic
1161625404 19:5323649-5323671 GTGAGGACGGGGAGAGAGGAAGG + Intronic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1161871679 19:6875334-6875356 ATGGTGATGGGGGGGGAGGATGG + Intergenic
1162110367 19:8396712-8396734 GGGGGGGGCGGGAGGGAGGAGGG + Intronic
1162145470 19:8610538-8610560 GTGGTGCCCTGGATGGGGGAGGG - Intronic
1162184454 19:8894195-8894217 GTGGGGCCAGGGAGGGATGATGG + Exonic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162448934 19:10742678-10742700 GTGGTGACCGGGATGGTGCCTGG + Intronic
1162771570 19:12952621-12952643 GTGATGACCTGGGGAGAGGAGGG + Intronic
1162886912 19:13703478-13703500 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1163238008 19:16040491-16040513 GTGGAGGAGGGGAGGGAGGAAGG + Intergenic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163565840 19:18050964-18050986 GGAGAGACAGGGAGGGAGGAAGG + Intergenic
1163582681 19:18147677-18147699 GTGGGCCCCAGGAGGGAGGAAGG + Intronic
1163721004 19:18898319-18898341 GTGCTGGCCGAGAGGGTGGAGGG - Intergenic
1164106007 19:22107682-22107704 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1164192106 19:22926177-22926199 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1164400679 19:27900137-27900159 GTGGTGGTTGGAAGGGAGGATGG - Intergenic
1164794393 19:31014557-31014579 GAGGTGAGAGGGAAGGAGGAAGG + Intergenic
1165192920 19:34079403-34079425 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1165192966 19:34079502-34079524 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1165246882 19:34503039-34503061 ATGGTGACCGGGATGGAGCAGGG - Exonic
1165276368 19:34755449-34755471 GTGGTCACTGTGAGGGAGGATGG + Intergenic
1165443560 19:35844405-35844427 GTGGTGACCGCGGTGGAGCAGGG - Exonic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1165743238 19:38216064-38216086 GTGCAGACCTGGAGGGAGGGAGG - Intronic
1165849703 19:38842707-38842729 GAGGTGACCTGGAGTGAGGGCGG - Intronic
1165959044 19:39519206-39519228 GTGGAGGCCGGGTAGGAGGATGG + Intronic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166029869 19:40118217-40118239 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1167249114 19:48391377-48391399 GGGCTGAGCGGGAGGGAGGCAGG + Exonic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167324909 19:48818451-48818473 GTGGGCACTGGGAGGGAGGGAGG - Intronic
1167338675 19:48902088-48902110 GGGGTGACAGTCAGGGAGGAAGG + Intronic
1167596468 19:50430919-50430941 GTGGGAAGGGGGAGGGAGGAAGG + Exonic
1167649018 19:50719548-50719570 GCGGGGACCGGGGGGGAGGGCGG + Intergenic
1167665491 19:50820961-50820983 GTGGGGGCAGGTAGGGAGGAGGG + Intronic
1167904661 19:52649034-52649056 GTGGGGACCCGGCGGGAGAAGGG - Intronic
1168097606 19:54124474-54124496 GCGGTGGGAGGGAGGGAGGAAGG - Intronic
1168099620 19:54134141-54134163 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
1168099669 19:54134278-54134300 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
1168099990 19:54136280-54136302 GAGGTGAACGTGAAGGAGGATGG - Intergenic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168333115 19:55580847-55580869 GTGGTGGCGGGGAGGGAGGGGGG + Intergenic
924985324 2:264650-264672 GGGGTCACCTGGAGGGAGTAGGG - Intronic
925188838 2:1867059-1867081 GGGGAGAGAGGGAGGGAGGAAGG + Intronic
925779524 2:7369609-7369631 GTGGAGGCGGGGAGGAAGGAAGG + Intergenic
926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG + Intronic
926509077 2:13750590-13750612 GTGGTGTGGGGGAGGGGGGAGGG + Intergenic
926711091 2:15881429-15881451 GGGGTGGCGGGGAGGGTGGAGGG + Intergenic
926733736 2:16057131-16057153 GGGGTGAGAGGGAGGGAGGACGG - Intergenic
927019117 2:18999323-18999345 AGGGAGACAGGGAGGGAGGAAGG - Intergenic
929431744 2:41893204-41893226 ATCGTGCCGGGGAGGGAGGAAGG - Intergenic
929510452 2:42562406-42562428 GTGGGGAGGGGGAGGGAAGATGG - Intronic
929600214 2:43199985-43200007 CTGGAGCCAGGGAGGGAGGACGG - Intergenic
929614570 2:43297528-43297550 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
929614592 2:43297577-43297599 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
930137568 2:47917697-47917719 GTGGGGACAGTGAGGGAGGTGGG + Intergenic
930336637 2:50057191-50057213 GAGGGGACAGGGAGGTAGGAAGG - Intronic
930989312 2:57631579-57631601 GTGGGGGGCGGGAGGCAGGAAGG + Intergenic
931656211 2:64512178-64512200 GTCCTGTCCGTGAGGGAGGAGGG - Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932955343 2:76345293-76345315 GGGGTGGGGGGGAGGGAGGAGGG - Intergenic
933901505 2:86853620-86853642 TTGGTGTCCTGGAGAGAGGAAGG + Intronic
934735710 2:96688903-96688925 GGGGTGAAGGGGAGGGAGCAGGG - Intergenic
934847982 2:97674978-97675000 GAGGTGACAGGGAGGGACGCAGG - Intergenic
934971956 2:98770941-98770963 GTGATGACCGGGAAGATGGACGG - Intergenic
935592178 2:104853881-104853903 GTGGTGAGGGGGAGGGAGGCTGG + Intergenic
936012806 2:108936020-108936042 GTGGTGACCAGTAGGGAGGACGG - Intronic
936376006 2:111942072-111942094 GTGAAGGCCGGGAGGGAGGTGGG - Intronic
937044049 2:118841715-118841737 GGGCTGTCGGGGAGGGAGGAAGG + Intergenic
937241350 2:120464589-120464611 GAGGTGACCTGGAGGGAGACAGG - Intergenic
937423838 2:121780644-121780666 GTGGTGTGGGGGAGGGGGGAAGG + Intergenic
937701448 2:124867109-124867131 ATGATGAAAGGGAGGGAGGAAGG - Intronic
937919517 2:127119892-127119914 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
938006071 2:127788658-127788680 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
938035035 2:128028167-128028189 GTCGTGAGCGGGAGAGCGGACGG + Intergenic
938159665 2:128973856-128973878 CTGGTGGCAGGCAGGGAGGAGGG - Intergenic
938548890 2:132361313-132361335 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939853400 2:147327182-147327204 GTGGTTACCATGAGTGAGGAGGG + Intergenic
939936381 2:148298389-148298411 CTGGTGAGTGGGAGTGAGGAAGG + Intronic
940018273 2:149129900-149129922 GTGGTGTCTGGGAAGGAAGAAGG + Intronic
940165330 2:150764490-150764512 GTGCTGTCCAGGAGGGAGCAAGG - Intergenic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
941508411 2:166376061-166376083 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
941846918 2:170142488-170142510 TTGGAGACCGGGAAGGAGGCAGG - Intergenic
942069024 2:172298652-172298674 GTGGAGAATGGGAGAGAGGAAGG + Intergenic
942630243 2:177945856-177945878 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
942640433 2:178055348-178055370 GGGGTGGGGGGGAGGGAGGAGGG + Intronic
942965853 2:181891901-181891923 GAGGGGACAGGGAGGGAGGGAGG - Exonic
943009582 2:182430956-182430978 GTGGGGTCGGGGAGGGGGGAGGG + Intronic
943784476 2:191861913-191861935 GTGTAGACCAGGAGGCAGGAGGG - Intergenic
944635254 2:201670119-201670141 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
945102694 2:206275707-206275729 GTGGGGAGGGGGAGGGACGATGG + Intronic
945170427 2:206989493-206989515 ATGGGGACAGGGAGGGAGGTGGG + Intergenic
945463615 2:210141133-210141155 GTGGGGAAGGGAAGGGAGGAAGG - Intronic
945918118 2:215726144-215726166 GTGGGGACAGGGAGAGGGGAGGG + Intergenic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
947634565 2:231673464-231673486 GTGGGGAAGGGGAGGGAGCAGGG - Intergenic
948079322 2:235192612-235192634 GTGGGGTGGGGGAGGGAGGAGGG - Intergenic
948635054 2:239329494-239329516 GGGGTGTCCCGGTGGGAGGAGGG - Intronic
948635157 2:239329967-239329989 GGGGTGTCCTGGTGGGAGGAGGG + Intronic
1168916396 20:1491610-1491632 TAGGTGCCCGGGAGGGAGGTGGG + Intergenic
1169419577 20:5449137-5449159 GGGGAAACAGGGAGGGAGGAAGG - Intergenic
1169801285 20:9514929-9514951 TTGGCGACTGGGAGAGAGGACGG + Intronic
1170824882 20:19784879-19784901 GAGGTTACTGGGAGAGAGGAGGG + Intergenic
1171877713 20:30593840-30593862 GTGGGGAAGGGGAGGGACGAAGG + Intergenic
1172055310 20:32150597-32150619 GTGGAGGGAGGGAGGGAGGAAGG - Intronic
1172059107 20:32176270-32176292 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1172587925 20:36097798-36097820 GTGGTGAGTGGCAGGGATGAGGG + Intronic
1172618288 20:36304339-36304361 GTAGTGACCGTGAGGGAGAGAGG - Intergenic
1173006335 20:39142448-39142470 GTGGTGAGGGGGAGGGAGGGGGG + Intergenic
1173281097 20:41628703-41628725 GTGGTGGGAGGGAGGAAGGAGGG - Intergenic
1174570879 20:51500628-51500650 GTGGTGAGGGTGAGGGTGGAGGG - Intronic
1176087369 20:63304208-63304230 GTGCACACCTGGAGGGAGGAAGG - Intronic
1176087478 20:63304568-63304590 GTGCACACCTGGAGGGAGGAAGG - Intronic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1176145945 20:63565544-63565566 ATGGTGACCGTCGGGGAGGACGG - Exonic
1176200026 20:63855903-63855925 GTGGAGACGGGGAGGGGAGAAGG + Intergenic
1176411816 21:6453326-6453348 GTGGTGACAGGGAAAGTGGAAGG - Intergenic
1176733491 21:10521916-10521938 GAGGGGACGGGGAGGGCGGAGGG - Intronic
1177178477 21:17720547-17720569 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1178394706 21:32232730-32232752 GTGGTTACCAGGAAGGTGGAAGG + Intergenic
1178914482 21:36699047-36699069 GGGGGGAGCGGGAGGGGGGAGGG - Intergenic
1179037670 21:37773493-37773515 GAGGTGAAGGGGAGGGATGAAGG - Intronic
1179086221 21:38220196-38220218 GAGGGCACAGGGAGGGAGGAGGG + Intronic
1179374779 21:40840843-40840865 GAGGTGGACGGGAGGGAGGAAGG + Intronic
1179411545 21:41167390-41167412 GTGGAGGCTGGGAGGGTGGAGGG - Intergenic
1179687310 21:43061648-43061670 GTGGTGACAGGGAAAGTGGAAGG - Intronic
1179826285 21:43968236-43968258 GTGGTGACTGGGAGTGAGCTGGG + Intronic
1180488062 22:15819539-15819561 GTGGTGACAGGCAGGGAATATGG + Intergenic
1181311348 22:21946527-21946549 GTGGTGACCAGATGGCAGGAGGG + Intronic
1181442736 22:22945032-22945054 CAGGTGACCAGGAAGGAGGAGGG + Intergenic
1181656324 22:24302875-24302897 GTGGTGACAGTGAGGGAGACAGG - Intronic
1181710216 22:24679776-24679798 GTGGTGAGCGGGAGAGTAGAGGG + Intergenic
1181728411 22:24827383-24827405 GTGGGGAGAGGGAGGGAGGGCGG + Intronic
1182129951 22:27843633-27843655 TTGGTGCCCAGGAGGGAGGCTGG + Intergenic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182616747 22:31592993-31593015 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1182616769 22:31593042-31593064 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1182820303 22:33210217-33210239 GTGGAGGCCGGGAGGGCGGCTGG - Intronic
1183057344 22:35315110-35315132 GTGGAGAATGGGTGGGAGGAGGG + Intronic
1183358236 22:37370611-37370633 GTGGAGAGAGGGAGGGAGGAAGG + Exonic
1183429049 22:37754877-37754899 GTGGTGAGCGAGGGGGAGGGAGG - Exonic
1183436029 22:37795781-37795803 GTGGTGGCCGTGGGGGTGGAAGG - Intergenic
1183500611 22:38176529-38176551 GTCTTGACTGGGTGGGAGGAGGG - Intronic
1183509611 22:38227179-38227201 GTGGAGGAAGGGAGGGAGGAAGG + Intronic
1183845304 22:40537092-40537114 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1184131364 22:42518593-42518615 GAGGTGAGCGGGAGGGAAGAGGG - Intronic
1184141586 22:42580805-42580827 GAGGTGAGCGGGAGGGAAGAGGG - Intergenic
1184265013 22:43342244-43342266 GAGGGGACCGGGTGGGAGGGTGG + Intronic
1184465437 22:44666721-44666743 GTGCTTGCCAGGAGGGAGGAGGG + Intergenic
1184607252 22:45581272-45581294 GTGGTGATCTGGAGGCTGGAGGG - Intronic
1184730283 22:46367903-46367925 GTGCAGAGAGGGAGGGAGGAAGG - Intronic
1184761435 22:46547020-46547042 GTGGTCACCGGGAGGGAGCAGGG + Intergenic
1185279093 22:49962330-49962352 GGGGAGAGAGGGAGGGAGGAGGG - Intronic
1185335655 22:50269965-50269987 GCCGTTACCGGGAGGGAGGGGGG - Intronic
949414508 3:3800269-3800291 CCGGGGACGGGGAGGGAGGAGGG + Intronic
950011585 3:9727971-9727993 ATGATGACAGGGAGTGAGGAGGG + Intronic
950099037 3:10346080-10346102 GTGGTGGCCGTGACGGGGGACGG - Exonic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950253649 3:11487599-11487621 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
950257535 3:11518064-11518086 ATGGTGAGTGGGAGAGAGGAAGG + Intronic
950667216 3:14504976-14504998 GTGGGTACCAGGAGGGAGGGAGG + Intronic
950794078 3:15496392-15496414 TAGTTGACTGGGAGGGAGGAGGG - Intronic
951013452 3:17705059-17705081 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
951013497 3:17705156-17705178 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
951013519 3:17705205-17705227 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
951013541 3:17705254-17705276 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
951179166 3:19638643-19638665 GTGGGGTGGGGGAGGGAGGAGGG + Intergenic
951297196 3:20952468-20952490 GTGGGGAAGGGTAGGGAGGAGGG + Intergenic
952261740 3:31746824-31746846 GGGGTGGGGGGGAGGGAGGAGGG + Intronic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952896485 3:38081802-38081824 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
953388190 3:42519032-42519054 GTCCTGACAGGGAGGCAGGAAGG - Intronic
953460214 3:43076111-43076133 GTGGGGACTGGGAGGGTGCAGGG + Intergenic
953780538 3:45866131-45866153 GTGGTGGCGTGGTGGGAGGAAGG + Intronic
953877293 3:46673608-46673630 GTGGTGACCAGTAGAGAGGGAGG + Intronic
953905411 3:46866072-46866094 GGGGTGAACAGGAGGCAGGAAGG + Intronic
953945055 3:47139184-47139206 GTGGAGGCTGAGAGGGAGGAAGG - Intronic
954059400 3:48056242-48056264 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
954063651 3:48088995-48089017 GTGGCGAGGGGGAGGGCGGAGGG + Exonic
954332083 3:49896509-49896531 GTGCTGGCCAGGAGGGAGGAAGG - Intronic
954411520 3:50373352-50373374 GAGGTCACTGGGAGGGAGGCTGG - Intronic
954924072 3:54217143-54217165 ATGGGGCCTGGGAGGGAGGAAGG + Intronic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955297438 3:57747660-57747682 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
955322732 3:57985874-57985896 GTGGAGACCAGGATGGAGCAGGG + Intergenic
955348163 3:58176105-58176127 GTGCTGAGCGGGAGGGAGGCAGG - Intergenic
955699478 3:61669825-61669847 GTGGTGACAGGGAGGAGGGAAGG + Intronic
955701969 3:61690618-61690640 GTGATGACGGAGAAGGAGGATGG - Intronic
955729826 3:61972994-61973016 GTGCTGTCCGGGAGGGAGTTAGG + Intronic
956270450 3:67444138-67444160 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
956677959 3:71753504-71753526 GAGGCGGCCGGGAGGGAGGCAGG - Intronic
957203215 3:77164466-77164488 GTGCTGTCCGGGAGGGAGGTGGG + Intronic
957203237 3:77164515-77164537 GTGCTGTCCGGGAGGGAGGTGGG + Intronic
957203310 3:77164691-77164713 GTGCTGTCCGGGAGGGAGGTGGG + Intronic
958808843 3:98838054-98838076 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
959042704 3:101439527-101439549 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
961120708 3:124368149-124368171 GTGCTGTCCGGGAGGGAGGTGGG - Intronic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
961333989 3:126159277-126159299 CTGGTGACGGGGCAGGAGGAGGG - Intronic
961486170 3:127218348-127218370 GTGGTGGCTGTGAGGGAGGTAGG - Intergenic
961495991 3:127291831-127291853 GTGGTGCCAGGGAGCAAGGAGGG - Intergenic
961965119 3:130894177-130894199 GAAGCGAGCGGGAGGGAGGAAGG - Intronic
961988191 3:131159229-131159251 GTGGTCACCTGGAGGAAAGAAGG - Intronic
962421232 3:135230710-135230732 GAGGTGAGAGGGAGGGAGGGAGG - Intronic
963284223 3:143417486-143417508 GGGGGGAGAGGGAGGGAGGAGGG + Intronic
963607675 3:147424784-147424806 GGGCAGACCTGGAGGGAGGAGGG - Intronic
963955389 3:151247611-151247633 GTGGGGTCGGGGAGGGGGGAGGG + Intronic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
966303490 3:178504645-178504667 GTGGTGTTGGGGAGGGGGGATGG + Intronic
966359645 3:179120146-179120168 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
966359667 3:179120195-179120217 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
966359987 3:179120920-179120942 GTGCCGTCCGGGAGGGAGGTAGG + Intergenic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968599541 4:1502513-1502535 GTGGTGACGGAGAGGGATGGTGG + Intergenic
968827422 4:2909481-2909503 GAGGAGACGGGGAGGGGGGAGGG - Intronic
968938305 4:3624853-3624875 GTGGGGTCTGGGAGGGATGAGGG + Intergenic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969481315 4:7448539-7448561 GTAGAGAAAGGGAGGGAGGAAGG - Intronic
969496824 4:7530990-7531012 GTGGTGGCCAGGGTGGAGGATGG + Intronic
970689978 4:18611627-18611649 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
970690142 4:18612087-18612109 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
970690228 4:18612325-18612347 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
971248209 4:24949429-24949451 GTGGTGGCAGGGAGGGGGGGTGG + Intronic
971960909 4:33486096-33486118 GTGGTGGCGGGGAGAGAGAATGG + Intergenic
973685568 4:53366119-53366141 GAGGAGGCCGGGAGTGAGGAAGG + Intergenic
973766543 4:54168266-54168288 GGGGGGACAGGGAGAGAGGAGGG + Intronic
974227122 4:59060540-59060562 GTGGTAGCAGAGAGGGAGGAGGG + Intergenic
974844204 4:67331575-67331597 GTGGTGAGCAGGTGGGAGGCAGG + Intergenic
978285558 4:107073375-107073397 GGGGTGAGGGGGAGGGGGGAGGG - Intronic
981025324 4:140071967-140071989 GTGGTGGACGTGGGGGAGGAAGG + Intronic
982025399 4:151248781-151248803 GGGGTGCCAGGCAGGGAGGAGGG - Intronic
982624291 4:157746041-157746063 GTGGTTACCAGGAGTGGGGAGGG + Intergenic
982794702 4:159630611-159630633 GTGTTGAGTTGGAGGGAGGAAGG + Intergenic
983425172 4:167574818-167574840 GTGGTGACCGAGAAGTAGAAGGG - Intergenic
983469055 4:168134771-168134793 GCTGTAACAGGGAGGGAGGAAGG - Intronic
984501663 4:180565912-180565934 TGGGTGACCGGGAGGGAGTTTGG + Intergenic
984614359 4:181879297-181879319 GTAGAGAGAGGGAGGGAGGAAGG + Intergenic
985567123 5:624682-624704 GCGGACACCAGGAGGGAGGAAGG + Intronic
985905443 5:2831511-2831533 GCGGTGGGTGGGAGGGAGGAGGG + Intergenic
986004029 5:3652607-3652629 GGGGTGACAAGGAGGGTGGAGGG + Intergenic
986773546 5:10994448-10994470 GCGGGGGCCGGGAAGGAGGAAGG + Intronic
987353606 5:17043017-17043039 GTGGTGAGAGGAAGGGAAGAGGG + Intergenic
988552063 5:32208228-32208250 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
989785181 5:45318413-45318435 GTGGGGTGGGGGAGGGAGGAAGG + Intronic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991705488 5:69354063-69354085 GTGGTGAGGGGGAGGCAGGACGG - Intronic
992373900 5:76171690-76171712 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
992373922 5:76171739-76171761 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
992470012 5:77043543-77043565 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
992761931 5:79958102-79958124 GCTTTGACCGGGAGAGAGGAGGG + Intergenic
993467778 5:88269141-88269163 GTGGGGAGCGGGAGGGGAGAGGG + Intronic
993902909 5:93596504-93596526 GAGGAGCCCGGGAGGGAGGCTGG - Intergenic
996135600 5:119838210-119838232 GTGGCGATCGGGGGGGAGTAAGG - Intergenic
996185200 5:120465328-120465350 GTGGCGACAGGGTGGAAGGAAGG - Intronic
996885958 5:128353981-128354003 GGGGAGACAGGGAGGGAGGATGG - Intronic
998207211 5:140166438-140166460 GTGCAGACAGGGAGGCAGGAAGG + Intergenic
998279069 5:140787560-140787582 GTGGTGACCGCGCGGGACGGGGG + Exonic
998282256 5:140823042-140823064 GTGGTGACCGCGCGGGACGGGGG + Exonic
998285565 5:140857315-140857337 GTGGTGACCGCGCGGGACGGGGG + Exonic
998288090 5:140883538-140883560 GTGGTGACCGCGCGGGACGGGGG + Exonic
998432119 5:142076350-142076372 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
998535057 5:142922529-142922551 GTGATGAAAGGGTGGGAGGAAGG - Intronic
998540847 5:142980062-142980084 GTGGTTACCTGGAGGGAGAAGGG - Intronic
998911778 5:146967752-146967774 CTGCAAACCGGGAGGGAGGAGGG - Intronic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999320903 5:150614449-150614471 GAGGTGAAGGGGAGGGAGAAGGG + Intronic
999787349 5:154903740-154903762 ACAGTAACCGGGAGGGAGGATGG + Intronic
1000249314 5:159479146-159479168 GTGGTTACAGGGAGAGAGGAAGG - Intergenic
1000297445 5:159924445-159924467 GAGGAAAACGGGAGGGAGGAAGG + Intronic
1000362973 5:160465282-160465304 GTGGAGACGGGGAGGGAGTGAGG + Intergenic
1001083462 5:168683786-168683808 GTGGTGAGTGGGAGGGAGAAAGG - Intronic
1001259547 5:170216072-170216094 GTACTGAGGGGGAGGGAGGAAGG - Intergenic
1001394150 5:171404093-171404115 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1001420176 5:171580161-171580183 GTGGTGAGTGGGAGGGAGCAGGG - Intergenic
1001772370 5:174305883-174305905 GTGATGACCGAGAGGCAGGCAGG + Intergenic
1001959763 5:175872692-175872714 GTGGGGACGGGGCGGGGGGAGGG + Intronic
1002013714 5:176305170-176305192 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1002013805 5:176305385-176305407 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1002052589 5:176579720-176579742 GTGGAGACTGGCTGGGAGGAAGG + Intronic
1002172547 5:177383639-177383661 TTGGTGACGGGGAGGGAGAGAGG - Intronic
1002899170 6:1396330-1396352 GAGGAGGCCGGGAGGAAGGAAGG - Intergenic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1004160226 6:13206143-13206165 GTGGGCACCAGGAGGGAGGACGG + Intronic
1004433767 6:15569972-15569994 GGGGTGAGAGGGAGGGAGAAGGG - Intronic
1004878191 6:19977547-19977569 GTGGTGATGGGGTGGGGGGAGGG - Intergenic
1006128424 6:31854325-31854347 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1006492324 6:34397648-34397670 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1006510297 6:34517729-34517751 GAGGGGACAGGGAGGGAAGATGG - Intronic
1006569603 6:34990713-34990735 GTGGTGGCTGGGAGAGAGAAGGG + Intronic
1006973919 6:38078703-38078725 GTGTTGACCGGGACTGAGGTTGG - Intronic
1007072629 6:39048499-39048521 GGGGTGCCAGGGTGGGAGGAGGG + Intergenic
1007521333 6:42453168-42453190 GTGGTGCCGGGGAGGAGGGACGG + Intergenic
1007674237 6:43580900-43580922 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1007695426 6:43729691-43729713 GTGGGGACTGGGAGGGAAGTAGG - Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008502089 6:52193459-52193481 CTGGTAACAGGGAGGGAGGATGG - Intergenic
1008920931 6:56843689-56843711 GGGGAGAGAGGGAGGGAGGAGGG + Intronic
1013177688 6:107691297-107691319 GTGGAGGCGGGGAGGGGGGAGGG - Intergenic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1016852505 6:148635531-148635553 GTGCTGACCCAGAGGCAGGAAGG + Intergenic
1016979408 6:149840591-149840613 GAAGTGCCTGGGAGGGAGGAAGG - Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017651268 6:156584786-156584808 GGGGTGAGGGGAAGGGAGGATGG + Intergenic
1017843967 6:158240755-158240777 GTGCCGACCGGGAGGGAGGTGGG - Intronic
1018698044 6:166405890-166405912 GTGGTGATGGGGAGAGAGGCAGG + Intergenic
1019445822 7:1070335-1070357 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1019451445 7:1100731-1100753 GTGGAGGCCGGGAGGCAGGGAGG - Intronic
1019454837 7:1121603-1121625 GTGGTCAGCGGAAGGGAGCAGGG - Intronic
1019616906 7:1967698-1967720 GTGGTGCCAGAGAGTGAGGAAGG + Intronic
1019630227 7:2045145-2045167 GTGGAGGCCGGGTGGGAGGCCGG - Intronic
1019644408 7:2121348-2121370 GTGGGGACAGGCAGGGATGAGGG + Intronic
1019869625 7:3747769-3747791 GTGGTAAGAGGCAGGGAGGAGGG + Intronic
1019983878 7:4641557-4641579 GTGGTGACCTGGATGGAGGGCGG - Intergenic
1020011341 7:4807506-4807528 GGGGAGACGGAGAGGGAGGAGGG - Intronic
1020061000 7:5152201-5152223 GTGGAGACCTGGAAGCAGGATGG - Intergenic
1021315537 7:19144126-19144148 GTGGCGAAGGGGAGGGAGAAAGG + Intergenic
1021376924 7:19919971-19919993 CTAGAGACTGGGAGGGAGGAGGG + Intergenic
1021451338 7:20785695-20785717 GAGCTGTCCGAGAGGGAGGAGGG + Exonic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021872341 7:25018633-25018655 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1021910954 7:25385663-25385685 GTGGTCACCTGCAGGGAGAAGGG + Intergenic
1022311456 7:29200369-29200391 GTGGATAGAGGGAGGGAGGAGGG - Intronic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022629498 7:32071478-32071500 GGGGTGAAAGGGAGGGAGGGAGG - Intronic
1023670860 7:42575195-42575217 GTGGTGACCAAGATGGTGGATGG + Intergenic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1023782872 7:43673997-43674019 GTGGAGGGAGGGAGGGAGGAAGG + Intronic
1024172963 7:46809443-46809465 GTGGTGAAAGGAAGGGAGAAAGG - Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1025124839 7:56336142-56336164 GGGGTGGGAGGGAGGGAGGAAGG + Intergenic
1025519061 7:61696777-61696799 GTGGTGGGGGGGAGGGGGGAGGG + Intergenic
1025543385 7:62125423-62125445 GTGGTGGGGGGGAGGGGGGAGGG + Intergenic
1026678667 7:72449015-72449037 GGGGTGTCCAGGAGGGAGGTGGG + Intergenic
1026783346 7:73284281-73284303 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1026978143 7:74511269-74511291 TTGGTGACCTGTAGGGAGGGTGG + Intronic
1027266580 7:76498135-76498157 GTGGTGGCGGGCAGGGAGGGTGG + Intronic
1027317961 7:76996253-76996275 GTGGTGGCGGGCAGGGAGGGTGG + Intergenic
1027371163 7:77509407-77509429 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1027866120 7:83649193-83649215 GTTATGACTGGGAGGGAGGATGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031760843 7:125711257-125711279 GTGGTGGGGGGGAGGGGGGAGGG + Intergenic
1031958113 7:127963395-127963417 GTGGCGGCGGGGAGGGGGGAGGG - Intronic
1032056496 7:128688784-128688806 GTGGGGAGAGGGAGGGGGGAGGG - Intergenic
1032095236 7:128935001-128935023 GTGGGGAGCAGGGGGGAGGAGGG - Intergenic
1032121965 7:129162937-129162959 GGTGTGACCCAGAGGGAGGAAGG + Intronic
1032502230 7:132408849-132408871 GTGGGGGGCGGGAGGGAGGCAGG - Intronic
1032507530 7:132446929-132446951 GTGGGGAGAGGAAGGGAGGATGG - Intronic
1032553349 7:132806084-132806106 GGGGTGACAGGGAAGGAAGATGG + Intronic
1032578471 7:133081369-133081391 GTGGGGAGTGGGTGGGAGGAGGG + Intronic
1032743923 7:134766829-134766851 GGGCAGACAGGGAGGGAGGAAGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034322566 7:150198784-150198806 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1034432429 7:151047899-151047921 GTGGTACCCGGGAGGGTGGCAGG + Intergenic
1034682376 7:152938986-152939008 GTGTTCACTGGGAGGGAGGGAGG - Intergenic
1034978065 7:155459325-155459347 GGGGAGACAGGGAGAGAGGAAGG - Intronic
1035140225 7:156752304-156752326 GTGGTGACCTGGAGGGGATATGG + Intronic
1035470111 7:159104320-159104342 GTGCTGGCCGGGAGGAGGGAGGG - Intronic
1035973804 8:4284444-4284466 ATGGTGACGGGGAGGGAACACGG - Intronic
1036051093 8:5197701-5197723 GTGGTGGGGTGGAGGGAGGACGG + Intergenic
1036217119 8:6889907-6889929 GAGGGGACGGGGAGGGGGGATGG - Intergenic
1036767288 8:11556965-11556987 GTGGGGACAGGGAGGGATGGAGG + Intronic
1037720991 8:21443840-21443862 GTGGTAAGCGGTGGGGAGGAGGG + Intergenic
1037775784 8:21834795-21834817 GTGCTGGCCAGGAGGGAGGGAGG + Intergenic
1037902743 8:22697145-22697167 GAGGAAACCAGGAGGGAGGAAGG - Intergenic
1038016940 8:23523415-23523437 GGGGTTGCAGGGAGGGAGGAAGG + Intergenic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038785625 8:30612655-30612677 GTGCTGAGAGGGAGGGAGGCAGG - Intronic
1039475736 8:37838594-37838616 GGGGTGACCAGGAAGGAGAAGGG - Intronic
1039788769 8:40857094-40857116 CTGGTTACCTGGAGGGAGGGAGG + Intronic
1041097269 8:54362077-54362099 GTTGTGACAGGGAGTGAGGTGGG + Intergenic
1041444236 8:57932079-57932101 GGGGGGGCAGGGAGGGAGGAAGG + Intergenic
1041507845 8:58621087-58621109 GTGGAGGATGGGAGGGAGGAGGG - Intronic
1041796579 8:61753088-61753110 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1042049032 8:64685904-64685926 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1042303573 8:67310964-67310986 GTGGGGCCCGGGAGGGAGGTTGG + Intronic
1043058606 8:75472114-75472136 GTGGTAAGAGGTAGGGAGGAAGG - Intronic
1043392147 8:79802189-79802211 TTGGTGTCCAGCAGGGAGGAAGG - Intergenic
1044186398 8:89256884-89256906 GAGGTGAGAGAGAGGGAGGAGGG + Intergenic
1045237036 8:100361261-100361283 GTGGTGATGGAGAGGGAGGCAGG + Intronic
1045547328 8:103140661-103140683 GTGGGGACCGGAGGGGAGGGAGG + Intronic
1046311989 8:112449405-112449427 GTGGTGTCTGGGAGTGAGGTTGG + Intronic
1047204097 8:122789553-122789575 GTGGTGGTCCGGAGGGAGTAGGG + Intronic
1047767693 8:128002918-128002940 AGGGAGACAGGGAGGGAGGAAGG - Intergenic
1048872950 8:138813796-138813818 CTGGTGACCTGGAGAGAGGATGG - Intronic
1049541402 8:143210780-143210802 GTGGTGCCTGGGTGGGATGAGGG + Intergenic
1049752532 8:144291903-144291925 GTGGGGACCGGGAGGGAGCAGGG + Intronic
1049783550 8:144439843-144439865 GTGGTGACCCGCAGGGAGCCTGG - Intronic
1050361715 9:4836769-4836791 GTGGTGAAGGGCAGGGAGTAGGG + Intronic
1053255833 9:36615353-36615375 GTGCCGACCGGGAGGGAGGTGGG - Intronic
1053255856 9:36615402-36615424 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1053287540 9:36859581-36859603 GAGGAGCCGGGGAGGGAGGAGGG - Intronic
1053457266 9:38242218-38242240 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1053719980 9:40935649-40935671 GGTGTGAACGGGAGGCAGGAGGG + Intergenic
1053752011 9:41266612-41266634 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1054257532 9:62830942-62830964 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1054333781 9:63784780-63784802 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
1054452897 9:65412906-65412928 GTGGGGTCTGGGAGGGATGAGGG - Intergenic
1054746566 9:68859653-68859675 GTGGTATCCTGGAGGAAGGAAGG + Intronic
1055208377 9:73761393-73761415 GTGGTCACAGGGAGGAAAGAAGG + Intergenic
1055414252 9:76064368-76064390 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1055967409 9:81879079-81879101 GTGGGGAGTGGGAGGGAGAATGG + Intergenic
1056756227 9:89383577-89383599 GTGGTGGGCGGGAGGTAGGAGGG + Intronic
1056992497 9:91424209-91424231 GCGGCGACCGGGAGGGTGAAGGG - Intergenic
1057379420 9:94554729-94554751 GTGGTGACGGAGCGGTAGGAGGG - Intergenic
1057706439 9:97398375-97398397 GGGGAGCCCTGGAGGGAGGATGG - Intergenic
1057866623 9:98686823-98686845 GGGGTGACAGGGAGGAAGCAAGG - Intronic
1058156139 9:101518025-101518047 GAGGAGAAAGGGAGGGAGGAAGG - Intronic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058740479 9:107937608-107937630 GGGGTGATCTGGAGGGAGGGAGG + Intergenic
1059120867 9:111640931-111640953 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1059120889 9:111640980-111641002 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1059211081 9:112514429-112514451 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1059718681 9:116937301-116937323 GTGGTGACAGGGAATAAGGAAGG - Intronic
1060049562 9:120368049-120368071 GTGGTGAGAGGGAGGAATGAGGG + Intergenic
1060124034 9:121024294-121024316 GAGGGGAGCGGGAGGGGGGAGGG + Intronic
1060124067 9:121024349-121024371 GAGGGGAGCGGGAGGGGGGAGGG + Intronic
1060351600 9:122866371-122866393 GTGGGGAGAGGGAGGGGGGAGGG - Intronic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060583238 9:124770667-124770689 GAGGGGACCCGGGGGGAGGAGGG + Intronic
1060687130 9:125623786-125623808 GTGCCGTCCGGGAGGGAGGTGGG + Intronic
1061544200 9:131294472-131294494 GTGCTGCTCGGGAGGGAGAAGGG - Intronic
1061677931 9:132228966-132228988 GTGGTGACTGGGGGTGAGGGTGG - Intronic
1061983896 9:134118387-134118409 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1062218122 9:135399993-135400015 GTGGGGTCTGAGAGGGAGGAAGG + Intergenic
1062296786 9:135834902-135834924 CTGGTGACCGCGAGGGAAGATGG - Intronic
1062322322 9:135996498-135996520 GTGATGGCGGGGAGGGAGAAAGG - Intergenic
1062364410 9:136202140-136202162 GCGGAGAGAGGGAGGGAGGAAGG - Intronic
1062449195 9:136608413-136608435 GAGGTGAGAGGGAGGGAGGAGGG + Intergenic
1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1185459926 X:329070-329092 GGGGGGACGGGGAGAGAGGAGGG - Intergenic
1185459935 X:329090-329112 GGGGGGACGGGGAGAGAGGAGGG - Intergenic
1185621459 X:1453344-1453366 GCGGTGCCCGGGGGGGAGGCGGG - Intronic
1185627578 X:1493356-1493378 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1185708519 X:2282872-2282894 GGGGAGAGAGGGAGGGAGGAGGG + Intronic
1186359623 X:8826755-8826777 GTGGTTACCTGCAGGGAGGGAGG + Intergenic
1186607960 X:11111335-11111357 GCGGTGACCGAGTGAGAGGAAGG + Exonic
1186608048 X:11111684-11111706 GTGGTGACCCGGGTGGAGGAGGG - Intronic
1187090453 X:16090613-16090635 GTGGGGACAGGAAGGAAGGAGGG + Intergenic
1187600430 X:20823494-20823516 GTGGTGGGCGGGGGGGAGGGGGG + Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1187976434 X:24709251-24709273 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1187976479 X:24709349-24709371 GTGCTGTCCGGGAGGGAGGTGGG - Intronic
1187976501 X:24709398-24709420 GTGCCGTCCGGGAGGGAGGTGGG - Intronic
1188477167 X:30602480-30602502 GTGCCGTCCGGGAGGGAGGTGGG + Intergenic
1190241239 X:48659436-48659458 GAGGTGGCCGGGAAGGAGGTGGG - Intergenic
1190533699 X:51406534-51406556 GTCCTGACCGGGTGCGAGGAGGG + Intergenic
1191618107 X:63189655-63189677 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1191618129 X:63189704-63189726 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1191716226 X:64195502-64195524 GAAGTGACCGGCAGGCAGGAGGG + Intronic
1191850547 X:65582802-65582824 GAGGTGACAGGGAGGAAGGAGGG + Intergenic
1192180754 X:68914345-68914367 GAGGGGAGCGGGAGGGGGGATGG - Intergenic
1192523511 X:71822673-71822695 GTGGTGTCAGGGAGGGGGGAAGG + Intergenic
1192533963 X:71911980-71912002 GGAGTGGCCGGGAGGGGGGAGGG + Intergenic
1194461728 X:94177836-94177858 GTTGAGACAGGGAGGGAAGAAGG + Intergenic
1195025047 X:100868465-100868487 GAGGTGACCAGGAGGAAGCACGG - Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196404353 X:115347450-115347472 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1196404421 X:115347597-115347619 GTGCCGTCCGGGAGGGAGGTGGG - Intergenic
1196668193 X:118338399-118338421 GGGGTGAGGGGGAGGGGGGAGGG - Intergenic
1197749068 X:129952673-129952695 AAGGAGAGCGGGAGGGAGGAGGG - Intergenic
1198517818 X:137427047-137427069 GAGGTGGCTTGGAGGGAGGAAGG + Intergenic
1198677566 X:139146968-139146990 GTGGGGTGGGGGAGGGAGGAGGG + Intronic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199814646 X:151386851-151386873 GTGGAGAGAGGGAGGGAGGGAGG - Intergenic
1199825837 X:151498419-151498441 GTGTGGACAGGGAGGGAGGTGGG + Intergenic
1199860537 X:151797143-151797165 GTGGTGGCAGGTAGGGGGGAGGG - Intergenic
1199895824 X:152127312-152127334 GTCGTGAGTGGGAGGGGGGAAGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200133200 X:153862524-153862546 GTGGGGACCGGGTGGTAGGAAGG + Exonic
1200807028 Y:7443561-7443583 GAGGTGGGAGGGAGGGAGGAAGG - Intergenic
1201292317 Y:12432980-12433002 GTGGTGCCTGGGAGGCAGTAAGG - Intergenic