ID: 1160553439

View in Genome Browser
Species Human (GRCh38)
Location 18:79711002-79711024
Sequence TATTGGGATGGGGCAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 361}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160553439_1160553449 11 Left 1160553439 18:79711002-79711024 CCAGGCTCTGCCCCATCCCAATA 0: 1
1: 0
2: 2
3: 20
4: 361
Right 1160553449 18:79711036-79711058 CCCTGAAACTGCCCTTGAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 152
1160553439_1160553454 27 Left 1160553439 18:79711002-79711024 CCAGGCTCTGCCCCATCCCAATA 0: 1
1: 0
2: 2
3: 20
4: 361
Right 1160553454 18:79711052-79711074 GAGCTGGGCTTTTGTGTCTGTGG 0: 1
1: 0
2: 3
3: 23
4: 352
1160553439_1160553455 30 Left 1160553439 18:79711002-79711024 CCAGGCTCTGCCCCATCCCAATA 0: 1
1: 0
2: 2
3: 20
4: 361
Right 1160553455 18:79711055-79711077 CTGGGCTTTTGTGTCTGTGGAGG 0: 1
1: 0
2: 3
3: 38
4: 558
1160553439_1160553451 12 Left 1160553439 18:79711002-79711024 CCAGGCTCTGCCCCATCCCAATA 0: 1
1: 0
2: 2
3: 20
4: 361
Right 1160553451 18:79711037-79711059 CCTGAAACTGCCCTTGAGCTGGG 0: 1
1: 0
2: 0
3: 16
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160553439 Original CRISPR TATTGGGATGGGGCAGAGCC TGG (reversed) Intronic
900873097 1:5319317-5319339 TCTTTGTATGGTGCAGAGCCCGG + Intergenic
903013043 1:20343869-20343891 AATGGGGAGGGGGCGGAGCCTGG - Intronic
903724163 1:25428872-25428894 TACTGTGTTGGGGCAGAGGCAGG + Intronic
903769138 1:25753144-25753166 TATTGGGATGGGGCAGCCACTGG - Intronic
904448127 1:30591053-30591075 TATGAGGATGTGACAGAGCCAGG + Intergenic
905649721 1:39648041-39648063 CATGGGGTTGAGGCAGAGCCTGG + Intergenic
905869306 1:41394101-41394123 TGGGGGGATGGGGCAGAGGCAGG + Intergenic
906251056 1:44311423-44311445 TAATGAGATGAAGCAGAGCCCGG + Intronic
906583651 1:46956799-46956821 TTTTGGGATGAGGAAAAGCCAGG - Intergenic
906708992 1:47915467-47915489 TAGTGGGATGGGACTGGGCCAGG - Intronic
906734367 1:48110321-48110343 TCTGGGAATGGGGCTGAGCCTGG + Intergenic
906927047 1:50128884-50128906 TATTCACATGGTGCAGAGCCTGG - Intronic
907224996 1:52937565-52937587 AATTGGGATGGGTCAGAGATAGG + Intronic
913186246 1:116373116-116373138 TTTCGGGAGGGGGCGGAGCCAGG + Intronic
913250334 1:116908097-116908119 AATTGGGATGGGGAAGAGAAAGG + Intergenic
915575963 1:156777299-156777321 AAATAGGATGGGGCAGAACCAGG - Intronic
916080421 1:161228783-161228805 TGTTGGCCTGGGGCAGAGTCAGG - Exonic
920851096 1:209628157-209628179 GATCCGGATGGGGCAGTGCCAGG - Exonic
921392077 1:214626614-214626636 AACTGAGATGTGGCAGAGCCAGG - Intronic
1065095819 10:22279834-22279856 TATTGAGATGGGGAAGAGAGTGG - Intergenic
1065637650 10:27746488-27746510 TATAGGGATGGGGGAAAGCAAGG + Intergenic
1066759200 10:38737981-38738003 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1066962424 10:42234789-42234811 TACTGGGACAGGGCAGAGCAGGG + Intergenic
1067294745 10:44968861-44968883 CATTGGGAGGGGGCACAGCCTGG - Intronic
1069080687 10:64085284-64085306 TATTGGCATGGGGAAGTGTCAGG + Intergenic
1069827366 10:71262376-71262398 TGGGGGGATGGGGCAGGGCCAGG + Intronic
1069870247 10:71528696-71528718 TATTGGCAAGGAGTAGAGCCAGG + Intronic
1070978179 10:80622519-80622541 CATGGGGAAGGGACAGAGCCTGG - Intronic
1071333049 10:84580117-84580139 TACGGGGATGAGGCAGAGCTTGG + Intergenic
1073444833 10:103574444-103574466 TGTAGGGATGTGGCAGAGCTGGG + Intronic
1076579022 10:131494524-131494546 GATTGGGATGGAGCAGGGGCAGG + Intergenic
1077846787 11:6033950-6033972 TATAGAGATAGAGCAGAGCCAGG - Intergenic
1077915663 11:6610084-6610106 TAGTGGAAGGGGGCAGAGACAGG + Intronic
1079549569 11:21677306-21677328 TATTGGGATGGACCAGTCCCTGG - Intergenic
1080689717 11:34546243-34546265 TCATGGTATGGGGCACAGCCTGG - Intergenic
1080880054 11:36311342-36311364 GGCTTGGATGGGGCAGAGCCAGG + Intronic
1080897094 11:36455920-36455942 GATTGGGTGTGGGCAGAGCCAGG - Intronic
1081494191 11:43590223-43590245 AATTGGGCTGGGGCTGAGTCTGG + Intronic
1081613183 11:44575627-44575649 TAGTGGGATGGGGCAGGGTGGGG + Intronic
1081619331 11:44609733-44609755 TCTTGCGATGGGGCAGAGGGAGG + Intronic
1081796539 11:45824326-45824348 CAGTGCGATGGGGCAGAACCAGG + Intergenic
1082128225 11:48456717-48456739 TGGTTGGATGGGGCAAAGCCAGG + Intergenic
1082249194 11:49960701-49960723 TGGTTGGATGGGGCAAAGCCAGG - Intergenic
1082561772 11:54627642-54627664 TGGTTGGATGGGGCAAAGCCAGG + Intergenic
1083317016 11:61821914-61821936 GATTGGGATGGGGCAGAGGCAGG + Intronic
1083563783 11:63696123-63696145 TATTGTGATGAGGCCGGGCCTGG + Intronic
1083992707 11:66256935-66256957 AATTGGGATGGGGAAGGGTCAGG + Intergenic
1084033251 11:66493285-66493307 GGTTGGGAAGTGGCAGAGCCAGG - Intronic
1084045704 11:66566677-66566699 GGGTGGGATGGGGCAGAGGCTGG - Intronic
1084175031 11:67418574-67418596 TTTTGGGATGTGGCTGGGCCAGG - Intronic
1084601337 11:70147570-70147592 TACTGGGAAGAGGGAGAGCCAGG - Intronic
1085401493 11:76238613-76238635 TCTGGAGGTGGGGCAGAGCCAGG - Intergenic
1086107786 11:83165642-83165664 AATTTGGATGGTGCAGATCCAGG - Exonic
1086163841 11:83754012-83754034 ATTGGGGATGGGGCAGAGGCAGG - Intronic
1089375017 11:117988035-117988057 GACAGGGATTGGGCAGAGCCAGG + Intronic
1091123793 11:133079026-133079048 TATTGGGGTGGGGATGAGCTTGG - Intronic
1092283524 12:7115226-7115248 TCTTGGGATGGGGCAGAGTGGGG + Intergenic
1093941989 12:25065336-25065358 AACTGGTATGTGGCAGAGCCAGG + Intronic
1096471150 12:51876787-51876809 TATTGGTCTGGGGCACAACCTGG - Intergenic
1096778976 12:53981344-53981366 AATTCAGCTGGGGCAGAGCCTGG + Intergenic
1100256725 12:92890558-92890580 TATTGGTATTGAGCAGTGCCTGG - Intronic
1103970468 12:124667650-124667672 TAGAGGGATGGGGCTGAGCGGGG - Intergenic
1105293565 13:19070265-19070287 TGCTGGGATGGTGCAGAACCAGG - Intergenic
1107263278 13:38520395-38520417 GACTCGGCTGGGGCAGAGCCTGG - Intergenic
1113553333 13:111210659-111210681 TAGAGTGTTGGGGCAGAGCCAGG + Intronic
1115912516 14:38272209-38272231 TGTTGGGATTGAGCAGAGCAGGG - Intergenic
1117518123 14:56523004-56523026 TATTAGCCTGGGGCACAGCCTGG + Intronic
1117865782 14:60147759-60147781 TAAGGGCATGGGGCAGAGCTGGG + Exonic
1119427710 14:74546622-74546644 ATCTGGGATGGGGCAGAGCGAGG + Intronic
1120385493 14:83840299-83840321 TATTGTGATTGGCCAGAGCTTGG - Intergenic
1120900883 14:89574549-89574571 TCTTGGCAGGGGGCAGAGCTGGG - Intronic
1121632920 14:95433929-95433951 TAGTAGAATGGGGCAGAGCCAGG - Intronic
1122740432 14:103868847-103868869 AGGTGGGATGAGGCAGAGCCAGG - Intergenic
1123055735 14:105568751-105568773 CAGAGGGATGGGGCAGAGGCAGG + Intergenic
1123080092 14:105688270-105688292 CAGAGGGATGGGGCAGAGGCAGG + Intergenic
1123422358 15:20143636-20143658 TACTGGGACAGGGCAGAGCAGGG + Intergenic
1123442642 15:20302706-20302728 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1123531586 15:21150176-21150198 TACTGGGACAGGGCAGAGCAGGG + Intergenic
1124863710 15:33468879-33468901 TGGTGGCAGGGGGCAGAGCCTGG - Intronic
1126355189 15:47787967-47787989 TATAGGGGTGGGGGAGAGGCAGG + Intergenic
1127643236 15:60934805-60934827 GATTGTAATGGAGCAGAGCCTGG - Intronic
1127777590 15:62278556-62278578 TATTTGGATGAGGTAGAGGCAGG + Intergenic
1127983721 15:64052206-64052228 GATCTGGAGGGGGCAGAGCCGGG - Intronic
1128046283 15:64620482-64620504 TCTTGGGATGTGGTAGATCCTGG - Intronic
1128603436 15:69016502-69016524 CATTGACTTGGGGCAGAGCCAGG - Intronic
1128610057 15:69066045-69066067 TAGTGGGATGGGGATGGGCCTGG + Intergenic
1129712887 15:77829943-77829965 TCCTGGAATGGGGCAGAGCTGGG + Intergenic
1129962078 15:79696506-79696528 TATTGTTGAGGGGCAGAGCCAGG - Intergenic
1129982850 15:79890053-79890075 TATGGGGTGGGGGCAGATCCTGG + Intronic
1130242614 15:82210545-82210567 TATTGAGATGGCCCAAAGCCTGG - Intronic
1130996003 15:88904596-88904618 TACTGGGAAAGGACAGAGCCAGG - Intronic
1131401430 15:92128491-92128513 TAATGGGATGGGGCAGGGGATGG + Intronic
1131775000 15:95785269-95785291 TATTGGGCTGGGGGACAGTCAGG + Intergenic
1132871541 16:2117730-2117752 CATCCAGATGGGGCAGAGCCTGG - Intronic
1133146051 16:3787460-3787482 TAGTGGGATGGGGGACAGCAAGG - Intronic
1133146993 16:3795477-3795499 TAGTGGTATGGGGCAGAACATGG - Intronic
1133318350 16:4897841-4897863 TATTGGGCTGGGGCATGGCGGGG + Intronic
1133643539 16:7741036-7741058 GTTTGGGATGGGGCAGAGGGAGG - Intergenic
1133684616 16:8154476-8154498 TATTGGGATGGGACATAGTGAGG + Intergenic
1133924140 16:10180689-10180711 GATGGGGATGGGGAAGTGCCTGG - Intronic
1134052443 16:11146270-11146292 TAATGGGATGGGACAGGGCAGGG - Intronic
1134456958 16:14401955-14401977 CATTGGGCTGGGGCGGGGCCTGG - Intergenic
1134520988 16:14919165-14919187 CATCCAGATGGGGCAGAGCCTGG + Intronic
1134550584 16:15136808-15136830 CATCCAGATGGGGCAGAGCCTGG - Intronic
1134708664 16:16317816-16317838 CATCCAGATGGGGCAGAGCCTGG + Intergenic
1134715877 16:16357849-16357871 CATCCAGATGGGGCAGAGCCTGG + Intergenic
1134825463 16:17281001-17281023 TAGTGGGTTGGGGCTGGGCCTGG + Intronic
1134950940 16:18350829-18350851 CATCCAGATGGGGCAGAGCCTGG - Intergenic
1134958879 16:18394310-18394332 CATCCAGATGGGGCAGAGCCTGG - Intergenic
1135525570 16:23211479-23211501 TATGGAGATGGGGCTGAGCTGGG - Intronic
1136066481 16:27762243-27762265 AGTTGGCATGGGGCAGAGGCGGG - Intronic
1136169691 16:28481389-28481411 CATTGGGATTGGGCCGGGCCAGG - Intronic
1136399136 16:30008354-30008376 TTTTGGGAGGGGGCAGAGCTTGG + Intronic
1136409932 16:30070244-30070266 GAGTGGGAGGGGGCAGGGCCTGG - Exonic
1136723589 16:32341206-32341228 TACTGGGACAGGGCAGAGCAGGG + Intergenic
1136773352 16:32859129-32859151 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1136841921 16:33547251-33547273 TACTGGGACAGGGCAGAGCAGGG + Intergenic
1136862395 16:33711713-33711735 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1136897262 16:34002390-34002412 TACTGGGACAGGGCAGAGCAGGG + Intergenic
1137647512 16:50088756-50088778 TAGAGGCAGGGGGCAGAGCCAGG + Intronic
1140119829 16:72074010-72074032 GAGTGGGATGTGGCAGTGCCAGG - Intronic
1140128775 16:72139240-72139262 TACTGGGATCGGGCTGAGCTGGG - Intronic
1140752928 16:78042395-78042417 CACTGGGATGGGTTAGAGCCAGG + Intronic
1142111653 16:88335197-88335219 TTTTGGGGTGGTGGAGAGCCTGG - Intergenic
1142111663 16:88335251-88335273 TTTTGGGGTGGTGGAGAGCCTGG - Intergenic
1203002842 16_KI270728v1_random:176559-176581 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1203075771 16_KI270728v1_random:1121239-1121261 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1203123888 16_KI270728v1_random:1559896-1559918 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1203134448 16_KI270728v1_random:1712965-1712987 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1203152086 16_KI270728v1_random:1847548-1847570 TACTGGGACAGGGCAGAGCAGGG + Intergenic
1142575065 17:901440-901462 ACTTGGGATCTGGCAGAGCCGGG - Intronic
1144816419 17:18038839-18038861 TTTTGGGTTGGGGCCGAGCTGGG - Intronic
1144874892 17:18392397-18392419 GATCCCGATGGGGCAGAGCCTGG + Intergenic
1145157333 17:20552024-20552046 GATCCCGATGGGGCAGAGCCTGG - Intergenic
1145742802 17:27290285-27290307 TGTTGGGATGAGGCATAGCAGGG + Intergenic
1145799506 17:27673889-27673911 GATCCCGATGGGGCAGAGCCTGG - Intergenic
1146159512 17:30552426-30552448 GATCCCGATGGGGCAGAGCCTGG + Intergenic
1146437005 17:32859494-32859516 CATTGGGTTGGGGCACAGCAAGG - Intronic
1146844863 17:36176091-36176113 CATCCCGATGGGGCAGAGCCTGG - Intronic
1146857169 17:36264026-36264048 CATCCCGATGGGGCAGAGCCTGG - Intronic
1146863446 17:36324349-36324371 CATCCCGATGGGGCAGAGCCTGG + Intronic
1146873081 17:36387936-36387958 CATCCCGATGGGGCAGAGCCTGG - Intronic
1146880439 17:36439022-36439044 CATCCCGATGGGGCAGAGCCTGG - Intronic
1147066306 17:37924937-37924959 CATCCCGATGGGGCAGAGCCTGG + Intronic
1147075964 17:37988561-37988583 CATCCCGATGGGGCAGAGCCTGG - Intronic
1147077839 17:38004498-38004520 CATCCCGATGGGGCAGAGCCTGG + Intronic
1147087489 17:38068107-38068129 CATCCCGATGGGGCAGAGCCTGG - Intronic
1147093775 17:38128433-38128455 CATCCCGATGGGGCAGAGCCTGG + Intergenic
1147103431 17:38192056-38192078 CATCCCGATGGGGCAGAGCCTGG - Intergenic
1147499725 17:40951030-40951052 TCTTGGGATGGGTCAAAACCAGG + Intergenic
1148787505 17:50152421-50152443 TATTGGGATCGGGAGGGGCCAGG + Intergenic
1149529589 17:57384201-57384223 AATTTGGATGGGGCATAGCAGGG + Intronic
1149591540 17:57833361-57833383 TACTGGGATGGGGTAGAGATGGG - Intergenic
1149848010 17:60018553-60018575 GATCCCGATGGGGCAGAGCCTGG - Intergenic
1150086363 17:62275156-62275178 GATCCCGATGGGGCAGAGCCTGG - Intronic
1150176793 17:63066094-63066116 TATTGGGATGGGCCTGGACCTGG + Intronic
1150235435 17:63589215-63589237 TTTGGGGGTGGGGCAGAGGCAGG - Exonic
1150288629 17:63968378-63968400 TATTGGCAGGGGGCAGGGCAGGG + Intronic
1151094057 17:71476097-71476119 TCTTGGGAAGGGGCAGAGACTGG - Intergenic
1151225969 17:72648675-72648697 TCTTGGGAAGGGGCAGAGAGGGG + Intronic
1152250980 17:79212410-79212432 AATTGGGAACGGGCAGCGCCAGG - Intronic
1152282975 17:79396234-79396256 AATTTGGACTGGGCAGAGCCGGG + Intronic
1152408968 17:80112464-80112486 TTCTGGGATGAGGCAGAGGCTGG - Intergenic
1152730183 17:81966380-81966402 AGTGGGGATGGGGCAGGGCCAGG - Intergenic
1153120852 18:1725034-1725056 AATTGAGATGGGTCAGAGCTAGG + Intergenic
1155367600 18:25063986-25064008 TATTGGCATGAGTGAGAGCCAGG - Intronic
1157274719 18:46302446-46302468 GAATGGGATGGGGCAGAGTGGGG - Intergenic
1160299884 18:77669804-77669826 GACTGGCATGGGGCAGAGACGGG + Intergenic
1160299910 18:77669940-77669962 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160299914 18:77669957-77669979 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160299926 18:77670008-77670030 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160299934 18:77670042-77670064 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160299966 18:77670195-77670217 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160299978 18:77670246-77670268 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160299986 18:77670280-77670302 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160299990 18:77670297-77670319 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300002 18:77670348-77670370 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300016 18:77670416-77670438 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300028 18:77670467-77670489 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300036 18:77670501-77670523 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300040 18:77670518-77670540 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300052 18:77670569-77670591 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300060 18:77670603-77670625 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300064 18:77670620-77670642 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300094 18:77670773-77670795 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300106 18:77670824-77670846 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300110 18:77670841-77670863 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300114 18:77670858-77670880 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160300168 18:77671130-77671152 GACTGGCATGGGGCAGAGACTGG + Intergenic
1160553439 18:79711002-79711024 TATTGGGATGGGGCAGAGCCTGG - Intronic
1161663919 19:5563554-5563576 AGCTGGGAAGGGGCAGAGCCAGG - Intergenic
1163238515 19:16043769-16043791 TTTAGGGATGGGCCAGAGCAAGG + Intergenic
1163271020 19:16253944-16253966 TCTTGGAATGGAACAGAGCCAGG - Intergenic
1163373703 19:16916888-16916910 TAATGGGGTGGGGATGAGCCTGG - Intronic
1164555592 19:29248535-29248557 TTTTGGAATCGGGCAGAGCTGGG - Intergenic
1165585022 19:36907362-36907384 GATTGGGAAGGGGCAGAGAAGGG + Intronic
1165702275 19:37947734-37947756 AGCTTGGATGGGGCAGAGCCTGG + Intronic
1166105182 19:40594652-40594674 TACAGTCATGGGGCAGAGCCGGG + Intronic
1166157219 19:40922780-40922802 TATTGGGCTGGGGGACAGTCAGG + Intergenic
1166333712 19:42092695-42092717 CACTGGGATGAGACAGAGCCAGG - Intronic
1166777236 19:45320538-45320560 AACTGGGATACGGCAGAGCCAGG - Intronic
1166999435 19:46737203-46737225 AGCTGGGATGGGGCAGAGCTGGG - Intronic
1167100105 19:47399378-47399400 TATGGGGGAGGGGCAGGGCCAGG - Intergenic
1167243309 19:48358498-48358520 TACTGGGATGGGGGAGACCGTGG - Intronic
1167496183 19:49819775-49819797 CAGGGGGATGGGTCAGAGCCAGG + Intronic
1168692255 19:58384306-58384328 GTTTGGGATGCGGCAGGGCCAGG + Intergenic
925155740 2:1647970-1647992 TGTGGGGAGGGGGCAGAGCCAGG - Intronic
925488947 2:4370221-4370243 AATTGGGATGAGGTAGAGCTGGG + Intergenic
925635180 2:5935647-5935669 TATGGGGATGGGGCAGGGGCAGG - Intergenic
926558491 2:14388417-14388439 TTTTGGCAGGGGGCAGAGGCTGG + Intergenic
927207500 2:20619380-20619402 GAGTGGAATGGGGCAGAGCAGGG - Intronic
928167955 2:28984364-28984386 CATTGGGAAGGGACAGGGCCGGG + Intronic
928923916 2:36556580-36556602 AATTAGGAAGTGGCAGAGCCAGG - Intronic
929995130 2:46821352-46821374 TCTTTGGATGGGGCAGAACGGGG - Intronic
930843127 2:55870360-55870382 TGTTGGGTGGGGGCAGAGGCGGG + Intronic
931557319 2:63519320-63519342 TATTGGCATGGGGGTGACCCAGG - Intronic
932374586 2:71224481-71224503 CATTTGGATGAGGCAGAGGCAGG + Intronic
932422281 2:71608296-71608318 AATTGGGAAGGAGCAGATCCAGG + Intronic
933944751 2:87276276-87276298 GATGGGGATGGGGCAGAGGACGG + Intergenic
934322532 2:91982330-91982352 TACTGGGACAGGGCAGAGCAGGG - Intergenic
934460840 2:94213147-94213169 TACTGGGACAGGGCAGAGCAGGG - Intergenic
938143212 2:128812945-128812967 TGCTGGGAAGGGGCAGACCCGGG + Intergenic
944440661 2:199740277-199740299 TTTTGAGATGGAGCAGGGCCTGG + Intergenic
944667779 2:201971455-201971477 GACTGGCAAGGGGCAGAGCCAGG + Intergenic
944669468 2:201983351-201983373 TCTTCGGATGGGAGAGAGCCTGG + Intergenic
946020367 2:216636125-216636147 TCTTAGGCTGGGGCAGAGACTGG + Intronic
946324270 2:218976019-218976041 CATTAGCATAGGGCAGAGCCTGG + Intergenic
947846608 2:233249765-233249787 TACTGGGATGGGGCTGAGGTGGG - Intronic
948703635 2:239776338-239776360 TGATGGGATGGGGCAGCGGCAGG - Intronic
1170007998 20:11689765-11689787 TATTGGGATGAGGAAGAGGGAGG - Intergenic
1170136152 20:13075685-13075707 TTTGGAGATGGGGCAGAGACTGG + Intronic
1170353376 20:15466398-15466420 CATTGGTATGGGGCAAAGGCTGG + Intronic
1170644563 20:18185981-18186003 GGTTGGGATGGGGCAGAGAAAGG - Intronic
1170707000 20:18753037-18753059 TATTGCTAAGGTGCAGAGCCAGG + Intronic
1172435466 20:34926047-34926069 GCATGGGCTGGGGCAGAGCCTGG + Intronic
1173310847 20:41894859-41894881 TATTAGCATGAGGCAGTGCCAGG + Intergenic
1173687302 20:44932513-44932535 CCTTGGGAAGTGGCAGAGCCAGG - Intronic
1174401711 20:50279356-50279378 TGCTGGAAAGGGGCAGAGCCAGG - Intergenic
1174546718 20:51331300-51331322 GATCAGGATGTGGCAGAGCCAGG + Intergenic
1174587956 20:51623393-51623415 CATTGGGAAGCAGCAGAGCCGGG - Intronic
1175716510 20:61257969-61257991 ACTGGGGATGGGGCGGAGCCTGG + Intronic
1175781482 20:61685084-61685106 TGTTGGGATGGGGCAGGGAATGG - Intronic
1178542879 21:33469871-33469893 AATTTGGAAGGGGCATAGCCAGG - Intronic
1178588161 21:33887005-33887027 TATTGGGTTGAGGGAGAGACAGG - Intronic
1179521466 21:41948325-41948347 TTGTGAGCTGGGGCAGAGCCAGG - Intronic
1179593771 21:42428705-42428727 TATTGGGTAGGGGGAGAGCCTGG + Intronic
1179829287 21:43986040-43986062 CAGGGGTATGGGGCAGAGCCAGG - Exonic
1180150047 21:45942852-45942874 GATTGAGCAGGGGCAGAGCCAGG - Intergenic
1180250702 21:46585593-46585615 TATTGGGTGGGGGCAGGGCTAGG - Intergenic
1180549283 22:16528234-16528256 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1181001714 22:19990836-19990858 CAGTGGGGTGGGGCACAGCCTGG + Intronic
1181355408 22:22293602-22293624 TACTGGGACAGGGCAGAGCAGGG + Intergenic
1181433116 22:22894842-22894864 GGCTGGGCTGGGGCAGAGCCCGG + Intronic
1181767154 22:25100150-25100172 CAGTGGTGTGGGGCAGAGCCTGG + Intronic
1181959265 22:26611177-26611199 TATTGGTAAGTGGCACAGCCAGG - Intronic
1182828598 22:33286283-33286305 TATTGGATAGGGGCAGAGCTAGG + Intronic
1183199835 22:36378416-36378438 TTTTGGGATCAGGCAGAGCTAGG - Intronic
1183554789 22:38516725-38516747 CACTGGGATGGGGGAGAGCTTGG + Intergenic
1183739249 22:39661111-39661133 CATGGGGATTGGGCAGAGCTTGG - Exonic
1183976670 22:41516266-41516288 TGGTGGGAATGGGCAGAGCCAGG + Intronic
949740831 3:7231768-7231790 AATTGGGAAGAGGCAGAGCTGGG + Intronic
950044959 3:9943597-9943619 AGTAGGGATGGGGCAGGGCCTGG - Intronic
950111373 3:10420903-10420925 AATTGGGCTGGGGCATGGCCCGG + Intronic
951022982 3:17800415-17800437 TACTGGCATGCGGCAGTGCCAGG - Intronic
951449129 3:22817042-22817064 TACTGGGATGGGGCAGTGAGAGG + Intergenic
952572258 3:34731696-34731718 TCTTGGGATGGGGCAGGGGCGGG + Intergenic
952723275 3:36555570-36555592 TGTGGGGATGGGGCAGCACCAGG + Intergenic
953300609 3:41771954-41771976 TAGTGGGATTGGGGAGAGGCAGG - Intronic
954018505 3:47717673-47717695 ACTTGGGATGGGGCTGAGGCAGG - Intronic
954397316 3:50299591-50299613 TGCTGGGCTGGGGCAGGGCCTGG - Intergenic
954680436 3:52343119-52343141 CAGTGAGATGAGGCAGAGCCTGG + Intronic
954694376 3:52413131-52413153 TATTGGCAAGTGGCAGAGCTAGG - Intronic
954715093 3:52522969-52522991 TGGTGGGAAGGGGCAGAGCAGGG - Intronic
954928808 3:54261930-54261952 TATTAGGATGGGACATAGTCAGG - Intronic
956743326 3:72291732-72291754 TATTGTGAGGATGCAGAGCCTGG - Intergenic
957112461 3:75981895-75981917 TTTTGGGAGGGGGCAGAGGGTGG - Intronic
957399564 3:79691259-79691281 TTTTGGGAAGGGGCAGAGGATGG - Intronic
959299663 3:104581304-104581326 TATTGGGATTTAGCAGTGCCCGG - Intergenic
959734628 3:109644169-109644191 AACTGGGAAGTGGCAGAGCCAGG + Intergenic
960087441 3:113606312-113606334 AATTGGGACGGGGTACAGCCTGG - Intronic
961638550 3:128350167-128350189 CAGTGGAGTGGGGCAGAGCCAGG - Intronic
961772211 3:129258273-129258295 AGTTGGTAAGGGGCAGAGCCAGG - Intronic
961818651 3:129564163-129564185 TAGTGGGGTGGAGCAGAGGCAGG - Intronic
962176457 3:133160545-133160567 TATTGCAATAGGGCATAGCCAGG + Intronic
962405156 3:135094292-135094314 GACTGGGAAGGGGCAGGGCCTGG - Intronic
962407936 3:135116324-135116346 CATTGTGATGGGGTAGAGACAGG - Intronic
963275301 3:143324147-143324169 TATTGGGAGGGGGTAGAGGGAGG + Intronic
966640573 3:182185174-182185196 TACCAGGATGGGGCAGAACCGGG - Intergenic
967475742 3:189915343-189915365 TATTGTTATGGGGCTGAGCCAGG - Intergenic
969467219 4:7364922-7364944 AGCTGGGATGTGGCAGAGCCAGG - Intronic
969554606 4:7897921-7897943 TATTGGGATGGGGAAGACTATGG - Intronic
974194601 4:58556524-58556546 TATTGGGATTGTGCAGAGGCTGG - Intergenic
977325768 4:95572831-95572853 TACTGGGCTGGCTCAGAGCCAGG - Intergenic
980067413 4:128204888-128204910 CATTGGTTTGGAGCAGAGCCTGG + Intronic
981073196 4:140566944-140566966 AGCTGGGAGGGGGCAGAGCCAGG - Intronic
983043835 4:162961141-162961163 TGTTGGGAAGCGGCAGAGACGGG - Intergenic
985719679 5:1482523-1482545 GGGTGGGGTGGGGCAGAGCCAGG + Intronic
985719727 5:1482631-1482653 GGCTGGGGTGGGGCAGAGCCGGG + Intronic
985719777 5:1482744-1482766 TGGTGGGCTGGGGCAGAGCCAGG + Intronic
986445762 5:7819900-7819922 TCTGGGGGTGGGGAAGAGCCTGG - Intronic
987577732 5:19752556-19752578 CATTGGGTGGGGGCAGGGCCAGG - Intronic
989359453 5:40584102-40584124 ATTTGGGATGGGGAAGAGGCAGG + Intergenic
990407810 5:55509260-55509282 GGTAGGGAAGGGGCAGAGCCTGG + Intronic
990755380 5:59063590-59063612 TTTTGAGATGGGTCAGGGCCAGG + Intronic
992500064 5:77333425-77333447 CATTGGAATGGGGTAGAGTCGGG - Intronic
995784846 5:115816815-115816837 TCTTGGGAAGGCGCGGAGCCCGG - Exonic
996466429 5:123807810-123807832 AAATGGGATGGCACAGAGCCTGG + Intergenic
997605755 5:135174667-135174689 TATGGGGATGGGGCATAGGTGGG - Intronic
997792285 5:136771683-136771705 TTCTGGGATGGGGCACAGCTAGG + Intergenic
999425091 5:151480964-151480986 TATTGAGCTGGGGCAGTGACAGG + Intronic
999855865 5:155593115-155593137 TATTGGGTTTAGGCAGAGACTGG - Intergenic
999927557 5:156395730-156395752 TGTTAGGAAGGGGTAGAGCCTGG + Intronic
1002086208 5:176777153-176777175 TATTTGGATGGGGCAGGGCCTGG - Intergenic
1002414882 5:179114993-179115015 TAGGGGGATGGAGCAGAGGCTGG - Intronic
1006400405 6:33814127-33814149 TGGTGGGATGGGGCACAGCTGGG - Intergenic
1007418880 6:41707514-41707536 GATGGGGATGGGGCAGGGGCTGG - Intronic
1008492843 6:52103910-52103932 TCTTGGCATGGTTCAGAGCCAGG - Intergenic
1013642391 6:112098594-112098616 AGTTGGGAAGGGCCAGAGCCAGG + Intronic
1014535633 6:122610378-122610400 TACTGGGCTGGGGCGCAGCCAGG - Intronic
1014989305 6:128053835-128053857 CATTGGGGTGGGGCAGAGCATGG - Intronic
1015256393 6:131183713-131183735 GACTGGGACAGGGCAGAGCCAGG + Intronic
1016317613 6:142807913-142807935 TATGTGGATGAGGAAGAGCCTGG - Intronic
1016618183 6:146077318-146077340 TATTTGGATGGGGCACTTCCTGG + Intronic
1016944886 6:149521406-149521428 TGTTGGCAAGGGTCAGAGCCAGG + Intronic
1017278147 6:152594025-152594047 GAATGGGATGGGGCGGAGGCAGG - Intronic
1019547623 7:1586091-1586113 GCCTGGGCTGGGGCAGAGCCTGG + Intergenic
1019708511 7:2507765-2507787 TCTAGGCATGGGGCAGAGGCTGG - Intergenic
1020049705 7:5073236-5073258 TTTTGGGATGGGCCCGTGCCTGG + Intergenic
1020127558 7:5541499-5541521 CAGTGGGAAGAGGCAGAGCCAGG + Intronic
1021264159 7:18498358-18498380 AATTGGTATGGGGAACAGCCTGG + Intronic
1022941848 7:35249352-35249374 GGTTGGGATGGGGCAGAGGCTGG - Intronic
1024919330 7:54541985-54542007 CAATGGGATGGGGGAGAGACGGG - Intergenic
1026232766 7:68499703-68499725 CATGGGGATGGGGCACAACCTGG + Intergenic
1026553143 7:71385033-71385055 GATTGGGGTGGGGCAGTGCATGG + Intronic
1028417217 7:90594238-90594260 TACTGGGAAGGGGAAGAGCATGG + Intronic
1034333485 7:150304675-150304697 TTTTGAGATGGGGCAGTGCATGG - Intronic
1034664558 7:152805215-152805237 TTTTGAGATGGGGCAGTGCATGG + Intronic
1036096934 8:5734613-5734635 TTTAGGGATTAGGCAGAGCCAGG - Intergenic
1039056453 8:33540829-33540851 TATTAAGATGGGGCAGAGGCCGG - Intergenic
1039306824 8:36272383-36272405 TATTGATATGGGGCAGAGGCAGG + Intergenic
1039982123 8:42416646-42416668 CAATGGGATGGAGTAGAGCCTGG + Exonic
1041046286 8:53889562-53889584 TATTGGGAAGGGGTAGAGATGGG + Intronic
1042383723 8:68149720-68149742 ATTTTGCATGGGGCAGAGCCTGG - Intronic
1043738070 8:83772029-83772051 TATTTGGATGTGGCAGAAACTGG - Intergenic
1043935756 8:86140431-86140453 TGCTGGGACCGGGCAGAGCCTGG - Intronic
1046050972 8:109022280-109022302 TATTTAGAAGGAGCAGAGCCTGG - Intergenic
1046681237 8:117172422-117172444 TGCTGGGGTGGGGCAGAGGCAGG - Intronic
1047856601 8:128918110-128918132 GATTGGGATGAGTCAGAGCTAGG - Intergenic
1048203001 8:132392334-132392356 TACTGGGCTGGGGCAGGGCTCGG - Intronic
1048334360 8:133491858-133491880 TATGGGGGTGGGGCTGAGCCTGG - Intronic
1049720001 8:144111360-144111382 CAGTGGGCTGGGGCAGAGGCTGG - Intronic
1049803690 8:144529519-144529541 GATGGGGATGGGGTAGAGCTTGG + Exonic
1051418038 9:16863201-16863223 TATTGAGATGGGGCAGGGCGTGG - Intronic
1051598877 9:18852190-18852212 TATTAGCAAGTGGCAGAGCCAGG - Intronic
1053290754 9:36878393-36878415 TCATGTGATGTGGCAGAGCCAGG + Intronic
1053311838 9:37025414-37025436 TGTTGGGATGGGGGGGAGCGGGG + Intronic
1053691335 9:40588845-40588867 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1054273467 9:63048640-63048662 TACTGGGACAGGGCAGAGCAGGG + Intergenic
1054302595 9:63389816-63389838 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1054401367 9:64716316-64716338 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1054434975 9:65200636-65200658 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1054495414 9:65821045-65821067 TACTGGGACAGGGCAGAGCAGGG + Intergenic
1056196171 9:84230930-84230952 TGTTAGCATGGGGCAGAGGCAGG - Intergenic
1057750908 9:97792221-97792243 TACTGGGATGGGGAAGACCTGGG + Intergenic
1057778529 9:98030242-98030264 TGTAGAGATGGGGCAGAGGCAGG + Intergenic
1058953522 9:109925311-109925333 TAATGGGAAGGAGAAGAGCCAGG - Intronic
1059303586 9:113335738-113335760 TAATGGGATGAGGCAGGGCTGGG - Intronic
1060106071 9:120874402-120874424 TGGTGGGAGGGGCCAGAGCCTGG - Intronic
1060558564 9:124523461-124523483 AATTGGAATGGGGTAGAGCCTGG - Intronic
1060785732 9:126450497-126450519 CATGGGGATGGAGCAGGGCCGGG - Intronic
1060983753 9:127808320-127808342 GATTGGAATGGGGCAGCGGCAGG + Intronic
1061885060 9:133587256-133587278 TACTGGCATGGTGCAGAGCTGGG + Intergenic
1186195635 X:7108349-7108371 TCCTGGGATGGGGCTGAGGCTGG + Intronic
1186725033 X:12348539-12348561 TATTGGGAAGTGGGAGACCCAGG - Intronic
1186922077 X:14293196-14293218 CAGTGGGATGTGGAAGAGCCTGG - Intergenic
1188785651 X:34343156-34343178 TATGGGGCTGGAGGAGAGCCAGG + Intergenic
1190927343 X:54921646-54921668 TATTGGGAAGGGGCGGTGCGTGG + Intronic
1192591062 X:72359762-72359784 TACTGTGATGGGGCTGAGCGTGG + Intronic
1193215620 X:78860706-78860728 AATTGGGTTGTGGCAAAGCCAGG - Intergenic
1198047899 X:132920879-132920901 TATTGGGTGGGAGCAGAGGCAGG - Intronic
1198278547 X:135120097-135120119 TTTGGGGATGAGGCAGGGCCAGG - Intergenic
1198292414 X:135252419-135252441 TTTGGGGATGAGGCAGGGCCAGG + Intronic
1201190025 Y:11437506-11437528 TACTGGGACAGGGCAGAGCAGGG - Intergenic
1202583604 Y:26404421-26404443 TACTGGGACAGGGCAGAGCAGGG + Intergenic