ID: 1160554887

View in Genome Browser
Species Human (GRCh38)
Location 18:79718517-79718539
Sequence GACTGGAAGGCGTTGGTAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160554887 Original CRISPR GACTGGAAGGCGTTGGTAGC CGG Intronic
905076011 1:35270681-35270703 ACCTGGGAGGCGGTGGTAGCAGG + Intronic
905308651 1:37034983-37035005 GGCTGGACGGCGGTGGCAGCGGG + Intergenic
906148861 1:43576177-43576199 GCCTGGAAGGCCTGGGCAGCAGG - Intronic
912669784 1:111615037-111615059 GAATGGAAGGCATTTGTTGCAGG + Intronic
915275197 1:154783692-154783714 GACTGGAAGGAGAGGGGAGCTGG + Intronic
915507182 1:156365340-156365362 GACTGGAGGGAGGTGGCAGCAGG - Intronic
920126358 1:203696525-203696547 CACTGGAAGCTGTTGGTTGCCGG - Intronic
923792009 1:237119620-237119642 GAATGGAAGGAAGTGGTAGCTGG + Intronic
1063162042 10:3425545-3425567 GACTCAGAGGCGTTGGTAGGTGG - Intergenic
1067695169 10:48529307-48529329 AACTGGAAGGTGTGGTTAGCTGG - Intronic
1068248924 10:54410424-54410446 GACTGGAAAGCTCTGGAAGCTGG + Intronic
1072809482 10:98447634-98447656 GGCTGGAAGGGGTGGGTAGTGGG - Intergenic
1075010598 10:118866448-118866470 GACTGGAAGTCCTTTGCAGCTGG + Intergenic
1075317226 10:121462598-121462620 GACTATAATGGGTTGGTAGCAGG + Intergenic
1080410686 11:32022260-32022282 CAGTGGAAGGAGTTGGGAGCAGG - Intronic
1080956783 11:37106793-37106815 GACTGGGAGGCATTTGTAACTGG - Intergenic
1082966820 11:58974549-58974571 CTCTGGAAGGCTTTGGTATCAGG - Intronic
1083234612 11:61343621-61343643 GACTAGAAGGAGTTGGTATTAGG + Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1105416518 13:20217910-20217932 GACGGGAAGGAGTTGGGTGCGGG + Intergenic
1105564945 13:21536089-21536111 GACTGGAAGGAATTGGTAAAGGG + Intronic
1106629012 13:31451275-31451297 GTCTGGAAGGCTTTGAAAGCAGG + Intergenic
1115647103 14:35376253-35376275 GACTGGAAGTTCTTGATAGCAGG + Intergenic
1117732795 14:58740777-58740799 GACTGGAAGGAGTGGGAGGCAGG + Intergenic
1118491220 14:66262876-66262898 GACTGGAAGGCTTTAGGAGGGGG - Intergenic
1119879066 14:78085950-78085972 AACTGGAAGAGGTTGGGAGCTGG + Intergenic
1129221726 15:74135172-74135194 GAATGGCAGCCGTGGGTAGCAGG - Exonic
1132202088 15:99962084-99962106 GACTGGGAGGCCATGTTAGCTGG + Intergenic
1134189710 16:12111693-12111715 GACTGAATGGTGTGGGTAGCAGG + Intronic
1134246541 16:12544372-12544394 GAGTGGAAGGCGTTGTGAGGTGG + Intronic
1136548821 16:30970815-30970837 GACTAGAAGGTGGTGGCAGCTGG - Intronic
1137809570 16:51339916-51339938 GACTGGAAGGCCTAGGTGGAAGG - Intergenic
1138434203 16:56988293-56988315 GAGTGGAAGGCCTTCCTAGCAGG + Intergenic
1140717344 16:77738737-77738759 GCCTGGAAGGCTTATGTAGCGGG - Intronic
1140985768 16:80156809-80156831 GACTGGAAGGCCATGGAATCAGG - Intergenic
1141034126 16:80613087-80613109 GAGTGGAAGGAGATGGTAACTGG - Intronic
1142906244 17:3044184-3044206 GACAGGAAGGAGTTGCTGGCAGG - Intergenic
1149293478 17:55239083-55239105 GGCTGGAGGGGGTTGGGAGCAGG + Intergenic
1155042357 18:22075251-22075273 TACTGGATGGCCTTGGGAGCAGG + Intergenic
1158128593 18:54128301-54128323 GACTGGATGGGGTTGGCAGCTGG - Intergenic
1158304794 18:56093466-56093488 GAATGGAAGACGTAGCTAGCAGG + Intergenic
1160554887 18:79718517-79718539 GACTGGAAGGCGTTGGTAGCCGG + Intronic
1161586368 19:5107960-5107982 GACTGGAAGGAGGTGGCGGCTGG - Intronic
1168560608 19:57379717-57379739 GACTGGATGGCCTGGGTAGAGGG - Intronic
937289977 2:120776312-120776334 GACTGGAAGGAGTCAGGAGCTGG - Intronic
937796620 2:126030191-126030213 GACTGGAAGGAGATGGTTCCAGG + Intergenic
946040679 2:216780760-216780782 GACTGGATGACTTTGGTAGTGGG + Intergenic
946688788 2:222295671-222295693 GGCGGGCAGGCGTTGGTACCCGG + Intronic
1174844252 20:53928219-53928241 GACTGGGAGGCGGAGGTTGCAGG - Intergenic
1180999787 22:19982642-19982664 GTCTGGCTGGCGTTGGTGGCGGG - Intronic
1181906900 22:26205218-26205240 GCCAGGAAGGCGTTGGTAATTGG - Intronic
1183451608 22:37898997-37899019 CAGTGGAAGGCGCTGGTCGCTGG - Intergenic
949534534 3:4985930-4985952 GACTGGGATGCTTTGGGAGCCGG - Intergenic
954817496 3:53294322-53294344 GAATGGAAGGAGTTGGTGGCTGG + Intronic
956252173 3:67245882-67245904 GACTGGAAGGAGATAATAGCTGG + Intergenic
957416349 3:79910186-79910208 GACTGGAAAGAGTTGATAACTGG + Intergenic
958502795 3:94936370-94936392 GAGTGTAAGGGGATGGTAGCAGG - Intergenic
962316939 3:134364818-134364840 GAATGGGAGTGGTTGGTAGCTGG - Intronic
969378116 4:6776536-6776558 GACTGGGAGACCTTGGTGGCAGG - Intergenic
969577011 4:8042125-8042147 GAGTGGAAGGCCTCGGAAGCAGG + Intronic
973829365 4:54742887-54742909 GAAAGGAGGGCGTTGGTAGTTGG + Intergenic
977919048 4:102624010-102624032 GGCTGGAAGGAGTGGGTAGGAGG - Intergenic
978979262 4:114922039-114922061 GACTGGAAGGCGGTGGGGGGTGG - Intronic
983608222 4:169614346-169614368 GCCTGGAAGGCGGAGGTTGCAGG - Intronic
986104046 5:4643072-4643094 GACTGGAAGGCTTAGGGACCAGG - Intergenic
999236751 5:150103165-150103187 GAGTCGAAGGCCTAGGTAGCTGG + Intronic
1005333442 6:24770462-24770484 GACTGGAGTGCAGTGGTAGCTGG + Intergenic
1006439940 6:34047673-34047695 GACTGGAAGGAGTTGGTGTTGGG - Intronic
1007806899 6:44457115-44457137 GAGTGGAAGGTGTTGGTGCCTGG + Intergenic
1009046031 6:58238305-58238327 GATTGGAAGGTGTTGGTATAAGG + Intergenic
1013606258 6:111751728-111751750 TACTGGGAGGCGTAGGTAGAAGG - Intronic
1016057059 6:139589070-139589092 GAATTGAAGTCGTTAGTAGCTGG + Intergenic
1020033900 7:4952172-4952194 GACTGCAAGCCGCTGGGAGCAGG - Intronic
1020596700 7:10215190-10215212 GCCATGAAGGTGTTGGTAGCTGG - Intergenic
1021856638 7:24863494-24863516 ACCTGGATGGCGTTGATAGCTGG + Exonic
1023737355 7:43246998-43247020 GAGTGGAAGGAGTTGGTGGCTGG + Intronic
1024470602 7:49765862-49765884 GAGTGGAGGGGGTTGGTAACCGG + Intergenic
1026090222 7:67293423-67293445 GAGTGGAAGGTGTTGGCAGGAGG + Intergenic
1026110252 7:67453737-67453759 GAGTGGGAGGCGTTGGAAGGAGG - Intergenic
1026746220 7:73015438-73015460 GAGTGGAAGGTGTTGGCAGGAGG - Intergenic
1026749871 7:73043581-73043603 GAGTGGAAGGTGTTGGCAGGAGG - Intergenic
1026753519 7:73071691-73071713 GAGTGGAAGGTGTTGGCAGGAGG - Intergenic
1026757170 7:73099727-73099749 GAGTGGAAGGTGTTGGCAGGAGG - Intergenic
1027032323 7:74899996-74900018 GAGTGGAAGGTGTTGGCAGGAGG - Intergenic
1027090234 7:75293759-75293781 GAGTGGAAGGTGTTGGCAGGAGG + Intergenic
1027093879 7:75321687-75321709 GAGTGGAAGGTGTTGGCAGGAGG + Intergenic
1027097522 7:75349654-75349676 GAGTGGAAGGTGTTGGCAGGAGG + Intergenic
1027119816 7:75508738-75508760 GAGTGGAAGGTGTTGGCAGGAGG + Intergenic
1027272012 7:76526869-76526891 GAGTGGAAGGTGTTGGCAGGAGG - Intergenic
1027321825 7:77018018-77018040 GAGTGGAAGGTGTTGGCAGGAGG - Intergenic
1027325459 7:77045938-77045960 GAGTGGAAGGTGTTGGCAGGAGG - Intergenic
1029717684 7:102341285-102341307 GAGTGGAAGGTGTTGGCAGAAGG - Intergenic
1033162695 7:139011465-139011487 GACTGGAAGGAGCTGGGGGCTGG - Intergenic
1033464344 7:141577587-141577609 GGCAGGAAGGCTATGGTAGCAGG - Intronic
1035182023 7:157096487-157096509 GCCTGGAAGGGGATGGCAGCAGG + Intergenic
1035560537 8:600998-601020 CAGTGGAAGGCGTTGGGAGTGGG + Intergenic
1035560557 8:601078-601100 CAGTGGAAGGCGTTGGGAGTGGG + Intergenic
1035560597 8:601238-601260 CAGTGGAAGGCGTTGGGAGTGGG + Intergenic
1035560618 8:601318-601340 CAGTGGAAGGCGTTGGGAGTGGG + Intergenic
1036815928 8:11902784-11902806 GACTGCAAGGCCTGGGTAGAAGG - Intergenic
1037608695 8:20458633-20458655 GACTGGAAGGTGATGGGGGCAGG - Intergenic
1037734194 8:21554039-21554061 GACTGGCAGGAGCTGGGAGCTGG - Intergenic
1041635136 8:60134331-60134353 CACTGGAAGGCACTGGTGGCAGG - Intergenic
1042664400 8:71190289-71190311 GACTGGAAGGCTTTGCTGTCTGG - Intergenic
1044225334 8:89711843-89711865 CTCTGGAAGGCTTTGGTATCAGG - Intergenic
1044284503 8:90395861-90395883 CTCTGGAAGGCTTTGGTATCAGG + Intergenic
1053844212 9:42219733-42219755 GAGAGGAAGGCGTTAGTTGCAGG + Intergenic
1056036060 9:82607104-82607126 GACTGGAAGGCTTTCAGAGCTGG - Intergenic
1056453269 9:86737020-86737042 GGCTGAAAGGCCTTGGTTGCTGG + Intergenic
1060341163 9:122778295-122778317 GACTGGCAGGGGGAGGTAGCAGG - Intergenic
1186961891 X:14745566-14745588 GAGGGGAAGGTGTTGGTTGCAGG - Intergenic
1187680072 X:21759031-21759053 GACTGGTAAGCGATGGTTGCTGG - Intergenic
1188755347 X:33954687-33954709 GACTGGGAGGGGGTGGAAGCTGG - Intergenic
1188811942 X:34661386-34661408 GACTGGAAGTGGGTGGTAGTTGG + Intergenic
1198125517 X:133639950-133639972 GACTGGCAGGAGTTGGGGGCCGG - Intronic