ID: 1160555318

View in Genome Browser
Species Human (GRCh38)
Location 18:79720862-79720884
Sequence GTCCAGCTTGGCCACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 239}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160555312_1160555318 -6 Left 1160555312 18:79720845-79720867 CCCCAGGCCACCTCACTGTCCAG 0: 1
1: 0
2: 1
3: 41
4: 351
Right 1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 239
1160555307_1160555318 16 Left 1160555307 18:79720823-79720845 CCAGGCTGCCCTCATCTCGGACC 0: 1
1: 0
2: 0
3: 19
4: 210
Right 1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 239
1160555311_1160555318 -5 Left 1160555311 18:79720844-79720866 CCCCCAGGCCACCTCACTGTCCA 0: 1
1: 0
2: 5
3: 50
4: 338
Right 1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 239
1160555314_1160555318 -8 Left 1160555314 18:79720847-79720869 CCAGGCCACCTCACTGTCCAGCT 0: 1
1: 0
2: 4
3: 32
4: 454
Right 1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 239
1160555305_1160555318 19 Left 1160555305 18:79720820-79720842 CCACCAGGCTGCCCTCATCTCGG 0: 1
1: 0
2: 1
3: 27
4: 225
Right 1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 239
1160555309_1160555318 8 Left 1160555309 18:79720831-79720853 CCCTCATCTCGGACCCCCAGGCC 0: 1
1: 0
2: 1
3: 25
4: 272
Right 1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 239
1160555304_1160555318 20 Left 1160555304 18:79720819-79720841 CCCACCAGGCTGCCCTCATCTCG 0: 1
1: 0
2: 1
3: 30
4: 248
Right 1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 239
1160555310_1160555318 7 Left 1160555310 18:79720832-79720854 CCTCATCTCGGACCCCCAGGCCA 0: 1
1: 0
2: 1
3: 13
4: 251
Right 1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 239
1160555313_1160555318 -7 Left 1160555313 18:79720846-79720868 CCCAGGCCACCTCACTGTCCAGC 0: 1
1: 0
2: 2
3: 39
4: 331
Right 1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160555318 Original CRISPR GTCCAGCTTGGCCACAGTGT TGG Intronic
900086380 1:899816-899838 GACCTGTCTGGCCACAGTGTGGG - Intergenic
900951301 1:5859530-5859552 CCTCAGCTTGGCCACAGTGGAGG + Intergenic
901914009 1:12483964-12483986 CTCCAGCTGGGCAACAGAGTGGG + Intronic
902820467 1:18940095-18940117 GCCAAGCTTGGCCCCAGTCTGGG + Intronic
904021411 1:27468889-27468911 CTCCAGCCTGGCAACAGAGTGGG + Intronic
904858580 1:33518225-33518247 GTGCAGCTTGGACATCGTGTTGG + Intronic
905644570 1:39616388-39616410 CTCCAGCCTGGCAACAGAGTGGG - Intergenic
905940820 1:41861895-41861917 GACCAGGCTGGCCACGGTGTTGG + Intronic
906315587 1:44784673-44784695 GGCCGCCGTGGCCACAGTGTAGG + Exonic
907176823 1:52531925-52531947 CTCCAGCTTGGCAGCAGAGTGGG - Intronic
907332580 1:53680898-53680920 GTTCACCTTGGGCACAGTGAAGG - Intronic
909729523 1:78874972-78874994 GTCCAAGTTGGCCCCAGAGTGGG - Intergenic
910277194 1:85462402-85462424 GACCAGCTTGGCTACAGTGTGGG + Intronic
910858303 1:91718480-91718502 GTCCACCTTTGACACAGGGTGGG - Intronic
911053914 1:93694948-93694970 GCCCAGGTGGGCCAGAGTGTAGG - Intronic
911536416 1:99105948-99105970 AACCAGCTTGGCCACAGTGCGGG + Intergenic
911752718 1:101516235-101516257 GACCAGCCTGGCAACATTGTGGG + Intergenic
912758852 1:112348140-112348162 GCCCACTTTGGCCAAAGTGTTGG - Intergenic
913193662 1:116434306-116434328 GTCCTGCTTAACCACACTGTGGG + Intergenic
913335167 1:117703207-117703229 GTCTAGTATGGCCACAGTGGAGG + Intergenic
915492456 1:156258761-156258783 CTCCAGCCTGGCAACAGAGTGGG + Intronic
917105989 1:171492604-171492626 GTCCAGGTTGGCAACAGAGCAGG + Intronic
920222328 1:204412734-204412756 CTCCAGCCTGGCGACAGAGTGGG - Intergenic
921189674 1:212699083-212699105 GACCAGGTTGGCCACAGGGACGG - Intronic
921905496 1:220491610-220491632 GTCATCCTTGGCCACAGTGGTGG + Intergenic
922385499 1:225076982-225077004 TTCCAGCTTGGACACAGGGCAGG - Intronic
922612996 1:226943933-226943955 GTCCTGCCTGGCCTGAGTGTGGG + Intronic
922881992 1:228988002-228988024 GTCATGCGTGGCCACAGAGTTGG - Intergenic
924734054 1:246738477-246738499 CTCCAGCCTGGCGACAGAGTGGG + Intronic
1062785555 10:261699-261721 CTCCAGCCTGGCAACAGGGTGGG + Intergenic
1062810271 10:458183-458205 GTCCTACTTGGCCGCACTGTAGG + Intronic
1063449504 10:6142086-6142108 GTCCAACTTGGCTACAAAGTTGG + Intergenic
1064209310 10:13349373-13349395 CTCCAGCCTGGCGACAGAGTGGG - Intergenic
1064274528 10:13893758-13893780 ACCCACCTTGGCCACAGTGTTGG + Intronic
1064297458 10:14091463-14091485 GTCCAGCCTGGTGACAGAGTGGG - Intronic
1066368053 10:34795647-34795669 GCCCACCTTGGCCAAAGTGCTGG - Intronic
1068734295 10:60394484-60394506 ATCCAGCTTGACCTCAGTGCTGG + Intronic
1069589539 10:69633229-69633251 GTCCAGCATTTCCAAAGTGTGGG + Exonic
1070197547 10:74172872-74172894 CTCCAGCTTGGTGACAGAGTGGG + Intronic
1074131898 10:110586687-110586709 CTCCAGCCTGGCAACAGAGTGGG - Intronic
1076126447 10:127977958-127977980 GACCAGCCTGGCCACAGAGTTGG - Intronic
1076226212 10:128778406-128778428 GACCAGCTTGGCCAACGTGTTGG + Intergenic
1076886685 10:133266310-133266332 CTCCCGAATGGCCACAGTGTGGG - Intronic
1077169216 11:1158919-1158941 GTCCGACTAGGCCACAGTGGAGG - Intronic
1077411164 11:2404627-2404649 GGCCAGCTTTTCCACAGTGCAGG + Exonic
1080477187 11:32607018-32607040 GCCCACCTTGGCCAAAGTGCTGG + Intronic
1083934592 11:65863650-65863672 GTGCAGCTTGCGCACCGTGTGGG - Exonic
1084004971 11:66317813-66317835 TTCCAGCTGGGCCAGCGTGTGGG + Intergenic
1085184608 11:74564902-74564924 GCCCAGCTTGGTCTCAGTGCTGG - Intronic
1085444458 11:76591217-76591239 TCCCACCTTGGCCACAGTGTAGG + Intergenic
1086937976 11:92765266-92765288 GTTCAGCTTAGCTACAGAGTTGG - Intronic
1088900627 11:114114194-114114216 GTCCATGTCGGCCACAATGTTGG + Intronic
1088910463 11:114187062-114187084 CTCCAGGTTTTCCACAGTGTTGG + Intronic
1089003746 11:115073717-115073739 GTTCAGCATGGCTACAGTATAGG + Intergenic
1089104291 11:115989386-115989408 GGCCACCCTGGCCACACTGTGGG + Intergenic
1089302530 11:117507331-117507353 ATCCAGAGTGGCCACAGTGGGGG + Intronic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1096697568 12:53360000-53360022 GTCCAGCTTGGGCAACGTATTGG + Intergenic
1098993791 12:77095472-77095494 GTCCAGCTTTGCCCCATTGCTGG + Intergenic
1101009543 12:100435352-100435374 CTCCAGCCTGGCCACAGAGTGGG - Intergenic
1101252548 12:102950426-102950448 GTCCAGGTTTGCCACGGTGGTGG + Intronic
1102471758 12:113163346-113163368 CACCAGCCTGGCCACAGTGAGGG + Intronic
1102734932 12:115151088-115151110 CTCCAGCCTGGCGACAGAGTAGG - Intergenic
1103146722 12:118601308-118601330 GTATAGCATGGCCAGAGTGTTGG - Intergenic
1103369067 12:120404419-120404441 ATCCAGCCTGGCCACAGGATTGG + Intergenic
1103916840 12:124380194-124380216 CTCCAGCCTGGCCACGGTGAAGG - Intronic
1104972298 12:132537383-132537405 GTCCAGCCTGTCCAGTGTGTGGG + Intronic
1106101173 13:26696001-26696023 GTCCAGCTGGGCGACAGGGAGGG - Intergenic
1107250488 13:38354144-38354166 GTCCAGATTGGCTACAGTAGTGG + Intronic
1108394984 13:49983171-49983193 CTCCAGCCTGGCCACAGAGCCGG + Intergenic
1109481588 13:62962927-62962949 GTTCAACTTGGACACATTGTTGG - Intergenic
1110238085 13:73237059-73237081 GTCAACATTTGCCACAGTGTGGG - Intergenic
1112210536 13:97373001-97373023 GTTCAGCAAGGCCCCAGTGTGGG + Intronic
1114530110 14:23390171-23390193 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1114535540 14:23419959-23419981 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1116904623 14:50392687-50392709 GTCCAGGTTGGAGACAGAGTTGG - Intronic
1117276340 14:54197743-54197765 GACCACATTGGCTACAGTGTTGG + Intergenic
1118288790 14:64502591-64502613 GTCAGGCATGGCCACTGTGTGGG - Intronic
1118791706 14:69099218-69099240 CTCCAGCCTGGCAACAGAGTGGG + Intronic
1119271997 14:73314484-73314506 ATCCAGCTCAGCTACAGTGTAGG + Intronic
1119300745 14:73569587-73569609 GTCCAGCTCGCCAAGAGTGTCGG - Exonic
1119856441 14:77904659-77904681 GTCCAGATTGGCATCCGTGTGGG + Intronic
1122097064 14:99380056-99380078 GTCCTCCTTGGCCGCAGTGAGGG + Intergenic
1122327366 14:100890700-100890722 GTCCATCTTGGCCTCCTTGTAGG + Intergenic
1122356390 14:101125541-101125563 GTCCAGCGTCTCCACACTGTAGG - Intergenic
1122365234 14:101191243-101191265 CTCCAGCATGGAGACAGTGTCGG - Intergenic
1122716059 14:103697827-103697849 GTAAGGCCTGGCCACAGTGTGGG + Exonic
1123771245 15:23531633-23531655 CTCCAGCCTGGCGACAGAGTGGG - Intergenic
1125364039 15:38894793-38894815 ATCCAACTTAGTCACAGTGTGGG + Intergenic
1125729623 15:41885865-41885887 AGCCAGCCTGGCCACAGTGGAGG - Exonic
1125849163 15:42887155-42887177 TTCCAAGTTGGCCCCAGTGTTGG - Intronic
1126328704 15:47509268-47509290 TCCCAGTTTGGGCACAGTGTAGG - Intronic
1126353655 15:47771571-47771593 GTCCACCTTCGCCCCAGTGGGGG - Exonic
1128808264 15:70550691-70550713 GCCCACCTTAGCCAAAGTGTTGG + Intergenic
1130304634 15:82704932-82704954 GTCCAAGTTGGCCTCAGAGTTGG - Intronic
1133534908 16:6692566-6692588 TTCCAGCTTTGCTAGAGTGTAGG - Intronic
1134057458 16:11179658-11179680 TTCCATCATGGCCACAGGGTCGG - Exonic
1134605306 16:15566301-15566323 GTCCCCCATGGCCACACTGTTGG + Intronic
1135110756 16:19689068-19689090 CTCCAGCCTGGCGACAGAGTGGG - Intronic
1135758767 16:25119438-25119460 TGTCAGCTTGGCCACAGTGACGG + Intronic
1137061028 16:35791924-35791946 GGCCAGAATGGCCACAGTTTGGG + Intergenic
1138489764 16:57369979-57370001 CTCCAGCTTGGGCACAGAGTGGG - Intergenic
1139613541 16:68075511-68075533 CTCCAGCTTGGCCTCAGCTTGGG + Intronic
1140028142 16:71310764-71310786 GTCCAGTTTGGACTCAGAGTGGG + Intergenic
1141139970 16:81490982-81491004 GTCCAGCCTGCACACAGTGGAGG + Intronic
1142049564 16:87949541-87949563 GTCCAGCGAGGCCACAGGGCTGG - Intronic
1142806720 17:2375346-2375368 GTGCCCCGTGGCCACAGTGTTGG + Intronic
1142957449 17:3531445-3531467 GCCCAGCTTGGCCACCGTCCTGG - Intronic
1142957885 17:3533528-3533550 CTCCAGCCTGGCGACAGAGTAGG - Intronic
1144013717 17:11173978-11174000 CTCCAGCCTGGCGACAGAGTGGG + Intergenic
1144650239 17:17002710-17002732 CTCCAGCTTTGCCACTGTCTCGG + Intergenic
1145357215 17:22169845-22169867 GTTCAGCTTGGTCACATTGTTGG + Intergenic
1146210520 17:30938994-30939016 GTCCAATGTGGCCACAGTCTGGG + Intronic
1147375485 17:40020229-40020251 GTCCAGCTTAGCCCCAGGTTCGG + Intronic
1147618076 17:41842690-41842712 GCCCATCTTGGCCAAAGTGCTGG - Intronic
1149125475 17:53225101-53225123 CTCCAGCCTGGCAACAGAGTGGG + Intergenic
1151500177 17:74483387-74483409 CTCCAGCCTGGCGACAGAGTGGG - Intronic
1151736945 17:75948797-75948819 GCCCGCCTTGGCCAAAGTGTTGG + Intronic
1151777487 17:76216183-76216205 GTCTAGGTTGACCTCAGTGTGGG + Intronic
1155404399 18:25472186-25472208 TTCCAGCTTTGCCAGAGTCTGGG + Intergenic
1157426488 18:47588789-47588811 CCCCAGCTTGGCCACAGTGATGG - Intergenic
1159054293 18:63449514-63449536 CTCCAGCCTGGCCACAGAGCAGG + Intergenic
1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG + Intronic
1160692020 19:464535-464557 GTCCAGCTTGGGCAAAGTCCTGG - Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161586333 19:5107783-5107805 GCTCAGCAGGGCCACAGTGTGGG - Intronic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1162748459 19:12812971-12812993 CTCCAGCCTGGCTACAGAGTGGG + Intronic
1162968794 19:14167997-14168019 GTCGGGCTTGTCCACTGTGTGGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165696512 19:37905198-37905220 CTCCAGCCTGGCGACAGAGTGGG + Intronic
1165872304 19:38981491-38981513 GTCCAGCTTTGCCTTAGTGATGG + Intergenic
1165993401 19:39828292-39828314 TGCCAGCTTGGCCAGAGGGTAGG - Exonic
1167350003 19:48968640-48968662 CTCTTGCTTGGCCAAAGTGTAGG + Exonic
1167449175 19:49556966-49556988 GTCCAACCTGGGCCCAGTGTGGG - Exonic
925865269 2:8221442-8221464 GTCCAGGAGGGGCACAGTGTGGG - Intergenic
926011777 2:9414200-9414222 GTCGAGGCTGGCCACAGTGCTGG + Exonic
926679950 2:15655394-15655416 TTCCAGGGTGGCCAGAGTGTAGG - Intergenic
927099282 2:19775509-19775531 GTTTAGCTTGGCCACAATGCTGG - Intergenic
927609505 2:24523892-24523914 CTCCAGCCTGGCAACAGAGTGGG + Intronic
927856808 2:26532855-26532877 GTCCAGCTTGGCCGCTGAGTGGG + Intronic
930073330 2:47387091-47387113 CTCCAGCCTGGCAACAGAGTGGG - Intronic
933494373 2:83029927-83029949 CTCCAGCCTGGCAACAGAGTGGG + Intergenic
934208317 2:89952255-89952277 GTGGAGCTAGGCCACAGTGGAGG - Intergenic
937705091 2:124911388-124911410 TTCCAGGTGGGCCACACTGTAGG + Intronic
938414969 2:131096664-131096686 CTCCAGCCTGGCAACAGAGTGGG + Intergenic
943081819 2:183265381-183265403 CTCCAGCTTGGCAACAGAGCGGG + Intergenic
944810169 2:203319856-203319878 CTCCAGCCTGGCGACAGAGTGGG + Intergenic
945258278 2:207820564-207820586 GGCCAGCTAGGCAAAAGTGTTGG - Intergenic
945335030 2:208581915-208581937 GGCCAGATTGGCCATAGTTTGGG + Intronic
945566953 2:211412920-211412942 CTCCAGCCTGGCAACAGAGTGGG + Intronic
946638580 2:221757865-221757887 CTCCATCTCTGCCACAGTGTTGG - Intergenic
946850452 2:223901283-223901305 CTTCAGCTTGGCCACAGAGTGGG - Exonic
948216983 2:236239370-236239392 ATCTAGCTCAGCCACAGTGTGGG + Intronic
948270361 2:236669249-236669271 CTCCAGCCTGGCAACAGAGTGGG - Intergenic
1169972244 20:11280393-11280415 GTCCAGCCTGGTGACAGAGTGGG + Intergenic
1171052751 20:21875359-21875381 GTCCATCATTGCAACAGTGTTGG - Intergenic
1171792396 20:29539086-29539108 CTCCAGCCTGGCCACAGAGCAGG + Intergenic
1173841400 20:46159539-46159561 GTCCAGCTGGGGCACAGGGAGGG + Intergenic
1174630642 20:51953982-51954004 GTCCTGGTTGGCCTCACTGTTGG + Intergenic
1175157647 20:56982732-56982754 CTCCAGCTTGGCCACATGCTGGG + Intergenic
1175206821 20:57317553-57317575 GACCATCCTGGCCACCGTGTGGG + Intergenic
1177319925 21:19508388-19508410 GGCAAGCTTGGCTACAGTTTGGG + Intergenic
1179434354 21:41350059-41350081 GTTCAGCTTGCCCTCAGTGTGGG - Intronic
1180023285 21:45142911-45142933 GTGCAGCATGGCCATGGTGTTGG - Intronic
1180761937 22:18217191-18217213 GTCTTGCTTTGCCACAGTCTGGG + Intergenic
1180773730 22:18407419-18407441 GTCTTGCTTTGCCACAGTCTGGG - Intergenic
1180797378 22:18612681-18612703 CTCCAGCCTGGCGACAGAGTGGG - Intergenic
1180805081 22:18656963-18656985 GTCTTGCTTTGCCACAGTCTGGG - Intergenic
1180805664 22:18712445-18712467 GTCTTGCTTTGCCACAGTCTGGG + Intergenic
1180970550 22:19812689-19812711 GTCCAGCGTGGCCCCGGGGTGGG + Intronic
1181192831 22:21154344-21154366 GTCTTGCTTTGCCACAGTCTGGG - Intergenic
1181216611 22:21338230-21338252 GTCTTGCTTTGCCACAGTCTGGG + Intergenic
1181282951 22:21732748-21732770 CTCCAGCCTGGCGACAGAGTGGG + Intronic
1182522197 22:30891008-30891030 GAACAGCTTGGCCAGAGTGTGGG - Intronic
1182885048 22:33766296-33766318 GACCAGCTTGGCCGAAGAGTTGG - Intronic
1183011120 22:34947433-34947455 GTGTAGCTGGGCCACAGTGAGGG + Intergenic
1184602339 22:45551079-45551101 GTCCAGCCTGGTGACCGTGTGGG + Intronic
1184905852 22:47486047-47486069 CTCCAGCCTGGCGACAGAGTGGG + Intronic
1203235562 22_KI270731v1_random:148393-148415 GTCTTGCTTTGCCACAGTCTGGG - Intergenic
951624118 3:24641568-24641590 TTCCAGGTTGGCCACTGTGGAGG - Intergenic
953972577 3:47358509-47358531 CTCCAGCCTGGCAACAGAGTGGG + Intergenic
954035326 3:47848182-47848204 GTCCTGCCTGGAGACAGTGTGGG + Exonic
954880240 3:53830923-53830945 CACCAGCTTGGCCACAGTGGAGG + Intronic
956872919 3:73435777-73435799 GACCAGCCTGGCAACTGTGTAGG - Intronic
959294920 3:104522766-104522788 CTCCAGCCTGGCGACAGAGTAGG + Intergenic
961724784 3:128920552-128920574 TTGCAGCTTGGACACAGTGTTGG + Intronic
962284833 3:134076901-134076923 GCCCAGATTGGCCAGAGTGTAGG + Intronic
962637340 3:137344757-137344779 GACCAGATGGGCCACAGGGTTGG - Intergenic
962966192 3:140356724-140356746 CTCCAGCCTGGCAACAGAGTTGG + Intronic
966054398 3:175665897-175665919 CTCCAGCCTGGCAACAGAGTGGG + Intronic
966140110 3:176747624-176747646 GTCCAACTTGGCAACATTGACGG - Intergenic
967326933 3:188250449-188250471 GTCCAGTTTCTCCACAGTATAGG + Intronic
967992464 3:195141731-195141753 GTCCAGCATCTCCACTGTGTGGG + Intronic
970148618 4:13065892-13065914 GTCCATCTTAGCCACAGACTAGG - Intergenic
973254632 4:48097448-48097470 CTCCAGCCTGGCGACAGAGTGGG - Intronic
974164081 4:58178172-58178194 CTCCAGCCTGGCAACAGAGTGGG - Intergenic
974192926 4:58531744-58531766 GTTCTGCTTGGCCACAGTGAAGG + Intergenic
975024215 4:69529519-69529541 TTCCAGCTTGCTCACAGTGGGGG - Intergenic
976436546 4:85024957-85024979 ATCCAGCCTGGCCAAATTGTGGG + Intergenic
976525646 4:86084198-86084220 TACCAGCTTGGCCACAGTGTGGG + Intronic
978026743 4:103885869-103885891 GTTCTGCTTGGCCACTGTATTGG - Intergenic
978807515 4:112816015-112816037 GTCCAGCTTGGCTACAAATTGGG - Intergenic
980639982 4:135565257-135565279 GCCCAGCTTGCCCACTGGGTTGG - Intergenic
980789478 4:137601410-137601432 GACCAGCTTGGCCAACGTGGTGG + Intergenic
982196278 4:152918644-152918666 CTCCAGCTTTGACACAGTTTGGG - Intergenic
984779859 4:183515188-183515210 CTGCAGCTTGGCCACAGTCCTGG - Intergenic
985629356 5:1006758-1006780 CTCCAGCTTGGGCACCCTGTAGG + Intergenic
985767046 5:1785633-1785655 CTCCAGCCTGGCAACAGAGTGGG + Intergenic
986046650 5:4044556-4044578 GGCCAGCTTAGCCACAGTGGGGG + Intergenic
987457907 5:18169789-18169811 TACCAGCTTGGCCACAGTGGGGG + Intergenic
987631469 5:20478258-20478280 CACCAGCTTGGCCATAGTGGGGG + Intronic
988822847 5:34904560-34904582 CTCCAGCCTGGCAACAGAGTGGG + Intergenic
990384242 5:55243783-55243805 CTCCAGCCTGGCAACAGGGTAGG + Intergenic
992058854 5:73021414-73021436 GTTCAGGTTGGCCTCAGTGAAGG - Intronic
993634925 5:90331930-90331952 GTCAAACTTGGCCAGAGGGTGGG + Intergenic
997293078 5:132751782-132751804 GCTCAGCTTGGCCACAGGATGGG + Exonic
1000607013 5:163336702-163336724 GTCCAAGTTGGCCCCAGAGTGGG - Intergenic
1001974003 5:175981878-175981900 CTCCAGCTGGGCAACAGAGTGGG + Intronic
1002243429 5:177861901-177861923 CTCCAGCTGGGCAACAGAGTGGG - Intergenic
1006010270 6:31037234-31037256 GTCCAGCTTGGCCTTGGTGAGGG + Intergenic
1006972913 6:38065281-38065303 CTCCAGCCTGGCGACAGAGTGGG + Intronic
1007776290 6:44226229-44226251 GCCCAGCTAGGCCTGAGTGTGGG + Intronic
1010600810 6:77823876-77823898 GTCCAGCTTGCTTACAGTGCTGG + Intronic
1012321316 6:97850269-97850291 CTACAGCTTGGCCACAGAGAAGG + Intergenic
1019500551 7:1362413-1362435 GACCAGCCTGGGCCCAGTGTGGG - Intergenic
1019733271 7:2638793-2638815 GTCCAGCTTGGCCGCATGGGGGG + Intronic
1022582929 7:31574790-31574812 GGGCAGGTGGGCCACAGTGTAGG + Intronic
1022775033 7:33518280-33518302 CTCCAGCCTGGCGACAGGGTGGG - Intronic
1024410010 7:49029426-49029448 GTCTAACTTGGCTACAGTGTTGG + Intergenic
1024716686 7:52087635-52087657 CTCCAGCCTGGGCACAGAGTGGG - Intergenic
1029559482 7:101293084-101293106 GCCCACCTTGGCCAAAGTGCTGG + Intergenic
1030192460 7:106823230-106823252 GACCAGCCTGGCCAAAGTGATGG - Intergenic
1030658070 7:112190279-112190301 GTCCGACTTTGCTACAGTGTAGG - Intronic
1033228626 7:139579966-139579988 GTTTGGCTTGGGCACAGTGTTGG - Intronic
1035443360 7:158922181-158922203 GGTCAGCTTGGACAGAGTGTTGG + Intronic
1036777204 8:11621589-11621611 GTCCAGCCTTGGCACAGAGTTGG + Intergenic
1037245979 8:16835202-16835224 CTCCAGCTTGGTGACAGAGTGGG + Intergenic
1041713933 8:60916626-60916648 GTTCAGCCTGGGCAGAGTGTGGG + Intergenic
1042162624 8:65912537-65912559 TAACAGCTTGGCCACAGGGTGGG + Intergenic
1043982660 8:86659101-86659123 GACCAGCTTGGCCAAACTGAGGG - Intronic
1044949710 8:97423725-97423747 GTCCAGCTTGGCTAGAGAGTTGG - Intergenic
1047519033 8:125580331-125580353 GTCCTGCGTGGCCAGAGTGTAGG + Intergenic
1048536598 8:135302196-135302218 CTCCAGCCTGGCAACAGAGTAGG - Intergenic
1048636774 8:136305027-136305049 GTCCACCGTGGCCCCACTGTGGG + Intergenic
1048786160 8:138052665-138052687 GACCAGCTTGGCCAACGTGATGG - Intergenic
1049255058 8:141609267-141609289 GTACAGACCGGCCACAGTGTGGG + Intergenic
1049782445 8:144435140-144435162 GGCCAGCCAGGCCACAGAGTGGG + Exonic
1057487108 9:95494294-95494316 GTCCAGCGTGGGCAGAGTGCCGG - Intronic
1057950341 9:99364757-99364779 GTCCACCTTGGCTAGAGTGAAGG - Intergenic
1059549867 9:115218053-115218075 TTCCAGCTCTGCCACAGTGCTGG + Intronic
1060050400 9:120374549-120374571 GTCCAGCCTGGAGTCAGTGTTGG + Intergenic
1060750563 9:126165793-126165815 GTCCAGCTTTTCCACTGGGTGGG - Intergenic
1060929716 9:127481282-127481304 CTCCAGCCTGGCGACAGTGCAGG - Intronic
1061964345 9:134004648-134004670 GGCCAGCTGGGCCACACTCTGGG - Intergenic
1062624268 9:137435855-137435877 GCCCAGCGTGGCCACAGCGAAGG - Intronic
1189470252 X:41308301-41308323 CTCCAGCCTGGCAACAGAGTGGG + Intergenic
1192202166 X:69073321-69073343 GTTCAGCTTGGCCAAAGTCGAGG - Intergenic
1192723927 X:73728085-73728107 CCCCAGCTTGGCGACAGAGTGGG + Intergenic
1193984858 X:88228219-88228241 TATCAGCTTGGCCACAGTGCGGG + Intergenic
1194762604 X:97812105-97812127 CTCCAGCCTGGCCACAGAGCGGG + Intergenic
1196108028 X:111917049-111917071 GATTAGCTTGGCCACAGTGTGGG + Intronic
1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG + Intergenic
1198846362 X:140916693-140916715 GTCCACCTTGGTCCCAGTGCTGG + Intergenic
1200078101 X:153561840-153561862 GTCCAGCGTGCCCGCAGGGTGGG + Intronic
1200081511 X:153579073-153579095 CTCCACCCTGGCCACAGTGCTGG - Intronic
1201563707 Y:15344671-15344693 CTTCCTCTTGGCCACAGTGTGGG - Intergenic