ID: 1160556264

View in Genome Browser
Species Human (GRCh38)
Location 18:79727301-79727323
Sequence GTGTTTCAGCCAAATGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160556262_1160556264 -5 Left 1160556262 18:79727283-79727305 CCAGTTGTACGTACATGGGTGTT 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1160556264 18:79727301-79727323 GTGTTTCAGCCAAATGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 162
1160556259_1160556264 28 Left 1160556259 18:79727250-79727272 CCTTTGAACAACACTGCTTTGGA 0: 1
1: 3
2: 20
3: 320
4: 970
Right 1160556264 18:79727301-79727323 GTGTTTCAGCCAAATGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 162
1160556257_1160556264 29 Left 1160556257 18:79727249-79727271 CCCTTTGAACAACACTGCTTTGG 0: 1
1: 0
2: 2
3: 25
4: 282
Right 1160556264 18:79727301-79727323 GTGTTTCAGCCAAATGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160556264 Original CRISPR GTGTTTCAGCCAAATGCAGG TGG Intronic
904478426 1:30779055-30779077 GTGGTGGAGCCAAAGGCAGGCGG + Intergenic
904596913 1:31652622-31652644 GTCTTTCATCCAAAGGCAGGTGG + Exonic
905904637 1:41609698-41609720 GTGTTCCAGCCACATGGAGCTGG + Intronic
907557585 1:55358216-55358238 GTGTATCAGCCCAGTGAAGGGGG + Intergenic
907733908 1:57093178-57093200 GGGTTTCAGGCAGAGGCAGGTGG + Intronic
907823528 1:57993576-57993598 GACTATCAGCCAAATGCAGCGGG - Intronic
911617574 1:100031640-100031662 TTTTTTCAGCCAAATGCAGATGG - Intergenic
912243710 1:107938908-107938930 GAGTTTCAGCCAATCTCAGGTGG + Intronic
914833299 1:151186765-151186787 GTGCTGGAGCCAAATGCAGTTGG - Intronic
915096102 1:153463742-153463764 GTCTTTAAGCCAAATCCAGCTGG - Intergenic
915838300 1:159195627-159195649 GTGTTTCAGCCAAATCAAATGGG - Intronic
917120565 1:171641505-171641527 GAGTTTGAGCCAGATGGAGGTGG + Intronic
920637678 1:207720143-207720165 GTGGTTCAGCCCAATTCACGAGG - Intronic
924350174 1:243107182-243107204 GTGTTTCATCCCAAAGCAGCCGG - Intergenic
924501137 1:244639217-244639239 GTGTTTCAGACAAAGGGAGAAGG - Intronic
1063285200 10:4679470-4679492 GAGTTTCAGCCAATCACAGGCGG + Intergenic
1063334943 10:5203179-5203201 GTGCTGCAGACAAATGCAGAAGG - Intronic
1067860207 10:49838733-49838755 TCTTTTCAGTCAAATGCAGGTGG - Intronic
1068418138 10:56752528-56752550 GTGAATGAGCCACATGCAGGAGG - Intergenic
1070289754 10:75106447-75106469 GTGTCTCAGCCAAAACCTGGTGG - Intronic
1070755281 10:78988153-78988175 GTGTTACAGCCAGAAGGAGGTGG + Intergenic
1073496035 10:103891886-103891908 CTTTTTCAACCAAATGCAGATGG - Intronic
1073728308 10:106260150-106260172 GTGTTTCAGGCAAGAGGAGGGGG + Intergenic
1074914441 10:117941865-117941887 GCTTTTCAGACAGATGCAGGAGG - Intergenic
1074941819 10:118243885-118243907 GGGAATCACCCAAATGCAGGGGG - Intergenic
1074944513 10:118268352-118268374 GTGTTTGAGCAACATGCAAGAGG - Intergenic
1076275136 10:129192189-129192211 GTTTTCCAGGCAAATGCAAGCGG + Intergenic
1076485959 10:130817308-130817330 CTGTTCCAGCCAAACGCAGTTGG + Intergenic
1078110634 11:8389055-8389077 GAGTTGCAGCCAAAGACAGGTGG + Intergenic
1080720289 11:34841799-34841821 GTGTTTCTACCCATTGCAGGAGG - Intergenic
1080804877 11:35643645-35643667 CTGTTTCAAGCAAAAGCAGGGGG - Intergenic
1080893775 11:36432098-36432120 GTGTTTCAGAAAAATGTAGTGGG + Intronic
1081566955 11:44266048-44266070 GTGCTCCAGACACATGCAGGAGG - Intronic
1088489949 11:110377214-110377236 GAGTTTCAGCCAATCACAGGTGG - Intergenic
1089379427 11:118017006-118017028 ATGTGACAGCCAAATGCAGAGGG + Intergenic
1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG + Intergenic
1103399209 12:120631383-120631405 ATGTTTTTGCCACATGCAGGAGG - Intergenic
1103905399 12:124325099-124325121 GTGTGGCAGCCACACGCAGGCGG - Exonic
1104673727 12:130698274-130698296 GTGTTTGAGTCAGATGGAGGCGG - Intronic
1106895182 13:34292380-34292402 ATGTTCTTGCCAAATGCAGGGGG - Intergenic
1108354575 13:49618808-49618830 TTGTTTCAGCCACTTGCAGTGGG + Intergenic
1109440850 13:62370927-62370949 CTGTGTCAGGCAAAGGCAGGAGG - Intergenic
1110471561 13:75865776-75865798 GAGCTTCTGACAAATGCAGGGGG - Intergenic
1112719897 13:102231762-102231784 GTGTTTCAGCCAGAAAGAGGTGG - Intronic
1115304996 14:31924434-31924456 GTGTTTCATCCCAATGGAAGAGG + Intergenic
1115931442 14:38500799-38500821 GTTTTTCAGCCAGTTTCAGGAGG + Intergenic
1117608166 14:57453519-57453541 TTTTTTCAACCAAATGCAGATGG - Intergenic
1117712635 14:58547878-58547900 GAGTCTCAGCACAATGCAGGAGG + Exonic
1118836133 14:69479315-69479337 GTGTTAGAGCCAAAGTCAGGAGG + Intergenic
1119177598 14:72580645-72580667 GGCTATTAGCCAAATGCAGGTGG + Intergenic
1121426756 14:93857775-93857797 GTGTTTGGGCCAACTTCAGGAGG + Intergenic
1121775258 14:96586338-96586360 GTGTTTCTGGCAAGTGCAGAAGG - Intergenic
1122722666 14:103730873-103730895 CTTTATCAGGCAAATGCAGGCGG + Intronic
1127542427 15:59953731-59953753 TTGTGTCACACAAATGCAGGTGG - Intergenic
1130959082 15:88647951-88647973 GGGTCTCAGCCAGATGAAGGAGG + Intronic
1130969545 15:88721281-88721303 GGGTCTCAGCCAACTGCAGTGGG - Intergenic
1135708571 16:24695940-24695962 GAATCTCAGCCAAATGCTGGTGG - Intergenic
1141452051 16:84111009-84111031 ATTTTTCAGCCTACTGCAGGAGG - Intronic
1141863990 16:86737192-86737214 GTGTGTCTGCCGCATGCAGGGGG + Intergenic
1148136110 17:45292974-45292996 GGGTTACAGGCAAATGCAGGAGG + Intronic
1148231745 17:45940252-45940274 GTGTTTAAGCCAAAGGCAGGAGG - Intronic
1151001263 17:70379697-70379719 GAGTTTCAGCCAATCACAGGTGG - Intergenic
1152209364 17:78994932-78994954 GTTTTGGAGGCAAATGCAGGAGG + Intronic
1156278752 18:35611647-35611669 TTGTATGTGCCAAATGCAGGAGG + Intronic
1158771150 18:60518822-60518844 ATGTTTCAGCCAGGTGCTGGTGG + Intergenic
1159830841 18:73276743-73276765 CTTTTTCAGGCCAATGCAGGAGG - Intergenic
1160015915 18:75140537-75140559 GGGTCTCAGCCCAGTGCAGGTGG - Intergenic
1160231783 18:77054382-77054404 GTGCTTCAGCCACACCCAGGAGG + Intronic
1160556264 18:79727301-79727323 GTGTTTCAGCCAAATGCAGGTGG + Intronic
1162723446 19:12675885-12675907 AGGTTTCAGCCACAAGCAGGGGG + Exonic
1163294274 19:16402204-16402226 TGGTTCCAGCCAAGTGCAGGCGG - Intronic
1166930610 19:46299107-46299129 GTGTTCCAGCCAAGAACAGGGGG - Intronic
927901338 2:26821145-26821167 GAGTTTCAGCCAATCACAGGTGG - Intergenic
928668795 2:33579171-33579193 GTTTTTCAACCAAATGCCGCTGG - Intergenic
929039669 2:37731646-37731668 CTGGTTCAACCAACTGCAGGGGG + Intronic
929489720 2:42385476-42385498 CAGTGTCAGCAAAATGCAGGAGG + Intronic
939001544 2:136741241-136741263 AAGTTGCAGCCAAATGCAAGGGG + Intergenic
939539307 2:143474061-143474083 GTGTTTCAGCCTAAGCTAGGAGG - Intronic
941620577 2:167773713-167773735 GTGTTTCTCCCAAAGGCAGTGGG + Intergenic
941783918 2:169478141-169478163 GTGTTCCAGGCAAAGGAAGGGGG + Intergenic
942031430 2:171965374-171965396 GTGTTTGTGCAAAATCCAGGTGG - Exonic
942655156 2:178207561-178207583 ATTTTTCAGCCAACTGCAGTTGG + Intronic
942676925 2:178436306-178436328 GTTTTTCAGACAAATGTAGTAGG - Exonic
943450677 2:188039061-188039083 TTATTTCAGCCAGGTGCAGGTGG - Intergenic
944658457 2:201900007-201900029 GTGGCTCACCCAAAGGCAGGTGG - Intergenic
945236488 2:207636391-207636413 CTGTTTCAGCCAAATGAATGGGG + Intergenic
947703084 2:232251925-232251947 GTGCTTCACCAAAATGAAGGAGG + Intronic
947913046 2:233814189-233814211 GTGTTTCAGCCAATAGAAGGAGG - Intronic
1170382886 20:15781257-15781279 GAGTTACAGTCAAATGCAGGTGG + Intronic
1171437349 20:25133703-25133725 GTGTTTCATCCAAAGACAAGTGG - Intergenic
1173567759 20:44054068-44054090 TTGATTCAGAGAAATGCAGGAGG - Intronic
1175132427 20:56799499-56799521 GTGTTCCAGCCAGATACATGGGG - Intergenic
1179179916 21:39036238-39036260 GTGATTCAACCCACTGCAGGTGG - Intergenic
1179242930 21:39608057-39608079 ATGGTGCAGCCAAATGCTGGAGG - Intronic
1179650735 21:42806947-42806969 GAGTCTCTGCCAAAGGCAGGTGG - Intergenic
1183402170 22:37610898-37610920 GGCTTTCAGCCAGAGGCAGGGGG + Intronic
949438778 3:4057722-4057744 ATGTCTCAGCCAAATAAAGGTGG + Intronic
949575374 3:5333545-5333567 GTAAATCAGTCAAATGCAGGTGG + Intergenic
949872475 3:8601092-8601114 GTGATTCAACTAAAGGCAGGAGG - Intergenic
949955659 3:9266687-9266709 GTGTTTCTGCCAAATGCCTAAGG - Intronic
950231738 3:11282011-11282033 GTGATTTAGACAAATCCAGGTGG + Intronic
953432240 3:42849731-42849753 GAGTTTCAGCCAATCGCATGTGG - Intronic
954976216 3:54697427-54697449 TTCGTTCAGCCAAATGAAGGCGG - Intronic
956634572 3:71350988-71351010 GTGTTTCACCGAAAGGCATGTGG + Intronic
956653112 3:71523321-71523343 GTGTTAAAGCCAGAGGCAGGGGG + Intronic
957278248 3:78116599-78116621 TTGCTTCAGCTAAATGAAGGAGG + Intergenic
959497463 3:107068088-107068110 GTGTTTTCTCCAAATGAAGGAGG - Intergenic
962866902 3:139454600-139454622 GAGCTCCAGCCAAATGCATGTGG - Intronic
970439715 4:16069956-16069978 GAGTTTCAGCCAATCGCAGGTGG - Intronic
970861413 4:20707425-20707447 GTGCTTCAGCCAAATACAGATGG - Intronic
971224945 4:24743335-24743357 GAGTCTCTGCCAAATGCAAGTGG + Intergenic
974578689 4:63765492-63765514 GTGTTTCAGAAGAATGTAGGTGG + Intergenic
978329011 4:107590962-107590984 GAGCTTCAGTCAATTGCAGGTGG + Intronic
979251765 4:118573365-118573387 GTGTTTCATCCCAAAGCAGCCGG + Intergenic
979865725 4:125750861-125750883 ATAATTCAGCTAAATGCAGGTGG + Intergenic
984472612 4:180195455-180195477 GTGTGTCAGAAAAATGCTGGTGG + Intergenic
985332696 4:188857580-188857602 CTTCTTCAGACAAATGCAGGTGG + Intergenic
991647576 5:68816578-68816600 TTGTTTCACCTAAATTCAGGTGG - Intergenic
998631081 5:143899322-143899344 GGGTTCCAGCAGAATGCAGGAGG + Intergenic
999521166 5:152351954-152351976 GTGTTACATGCACATGCAGGTGG + Intergenic
999846755 5:155490207-155490229 GTGTTTCTGCCAAATACAAGTGG + Intergenic
1000147365 5:158466545-158466567 CTCTTTCAGGCAAATGCAGGTGG + Intergenic
1000742178 5:164982832-164982854 GTGTTTGAGTCAAATGCAGATGG + Intergenic
1001545803 5:172569948-172569970 GCTTTTCAGCCAAAATCAGGGGG - Intergenic
1002543612 5:179923570-179923592 GAGTTTCAGCCAATCACAGGTGG + Intronic
1005498064 6:26406027-26406049 GAGTTCCAGCCTAAGGCAGGTGG + Exonic
1005502730 6:26444075-26444097 GAGTTCCAGCCTAAGGCAGGTGG + Exonic
1009404706 6:63297866-63297888 GTGTTTCAGCCAATCACAGGTGG + Intronic
1010937397 6:81878592-81878614 GGGTTTCAGCCAAGTGAAGAAGG + Intergenic
1013115723 6:107102459-107102481 GGGTTTCTGCCCACTGCAGGTGG - Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015186619 6:130424317-130424339 TAGTTTCAGAAAAATGCAGGAGG - Intronic
1015385041 6:132612607-132612629 GTATTTCAGCTAAATGCAGTTGG + Intergenic
1015985347 6:138879053-138879075 GTGTTTCAGCAGCAGGCAGGAGG - Intronic
1017036356 6:150270737-150270759 GAGTTTCAGCCAATCACAGGTGG - Intergenic
1017737424 6:157378122-157378144 TTTTTTCAACCAAATGCAGATGG - Intergenic
1019205301 6:170356689-170356711 TTTTTTCAACCAAATGCAGATGG - Intronic
1023616159 7:42022387-42022409 GTGTTTAATCTAAATGGAGGAGG + Intronic
1024560724 7:50643085-50643107 TTTTTTCAACCAGATGCAGGTGG + Intronic
1028116117 7:86999979-87000001 GTTTTTCAGTTAAATTCAGGGGG - Intronic
1028401760 7:90432662-90432684 CTTTTTCAGACAAATGCTGGGGG + Intronic
1028641373 7:93045334-93045356 GTGTGTGAGCCACATGCAAGTGG - Intergenic
1029565676 7:101335746-101335768 GTGTAACAGGCAAATGCAGTGGG - Intergenic
1030186560 7:106768120-106768142 GAGCTTCAGCCAATTGCAGATGG + Intergenic
1031002077 7:116427313-116427335 GTTTTTCAGACATATGAAGGAGG + Intronic
1031841238 7:126742110-126742132 TTTTTTCACCCAAATGCAGATGG - Intronic
1032463661 7:132129893-132129915 CTGCTCCAGCCACATGCAGGAGG + Exonic
1033589832 7:142799996-142800018 GTGATTCAGCAAAATGAAAGGGG + Intergenic
1037138307 8:15490277-15490299 GAGTCACATCCAAATGCAGGTGG + Intronic
1037702741 8:21289851-21289873 GAGTTTCAGCCAATCACAGGTGG - Intergenic
1040825375 8:51614371-51614393 GAGTCTCAGCCAATTGCAGGTGG + Intronic
1042359757 8:67869118-67869140 GAGTTCAGGCCAAATGCAGGTGG + Intergenic
1045886770 8:107107931-107107953 GGGCATCAGCCAAATGCAGGTGG + Intergenic
1046623481 8:116552666-116552688 GTGTCTCAGCCAAATCTATGTGG + Intergenic
1046772865 8:118134302-118134324 GTATTTCAGCCAGCTGCATGGGG - Intergenic
1051330770 9:16022876-16022898 GCATTTCAGCCACATCCAGGAGG + Intronic
1052468607 9:28863826-28863848 GTGTTTCAGCTAAAAGAGGGTGG - Intergenic
1052679465 9:31670639-31670661 GTGTTTTAGCCAATTACATGTGG + Intergenic
1052735775 9:32340924-32340946 GTGGTTCAATCAAAGGCAGGAGG - Intergenic
1053330997 9:37206880-37206902 GTGTTTCAGGCAGAGGCAGGGGG + Intronic
1055418629 9:76111609-76111631 GTGTTTCAGCTAAATGAATAGGG + Intronic
1055913560 9:81377326-81377348 GTGTTGCAGCCCAATGCAAAGGG - Intergenic
1059485356 9:114622703-114622725 GTGTTGCAGCCATACGTAGGAGG + Intronic
1062341041 9:136094200-136094222 GTGTTTCACCCACGTGCTGGTGG - Intronic
1185734089 X:2484401-2484423 GTGTTGCAGTCAGATGCGGGAGG - Intronic
1188070135 X:25708051-25708073 GTCATTCAGCCAAATGCATATGG + Intergenic
1188235342 X:27722710-27722732 GTGTTCCAGATAAAAGCAGGAGG + Intronic
1189223915 X:39396749-39396771 GGGTTCCAGCCAAATGCCAGAGG + Intergenic
1189835515 X:45017347-45017369 ATATTTCACCAAAATGCAGGTGG - Intronic
1189846186 X:45140979-45141001 GAGTTTCAGCCAATCACAGGTGG + Intergenic
1193313408 X:80036197-80036219 GTGTTGTAGCCAAATTCAGCAGG + Intergenic
1196599170 X:117582393-117582415 ATTTTTCAGACAAATGCAGAGGG - Intergenic
1197163249 X:123347103-123347125 GACTTTCAGCGAAATACAGGGGG - Intronic
1200736947 Y:6810125-6810147 GTGATTCAGCCATATACAGAAGG - Intergenic
1202119013 Y:21505714-21505736 GTCTCTCAGCCAAATGAATGTGG + Intergenic
1202121465 Y:21529254-21529276 GTCTCTCAGCCAAATGAATGTGG + Intronic
1202157538 Y:21900128-21900150 GTCTCTCAGCCAAATGAATGTGG - Intronic
1202159987 Y:21923669-21923691 GTCTCTCAGCCAAATGAATGTGG - Intergenic
1202183986 Y:22165052-22165074 GTCTCTCAGCCAAATGAATGTGG - Intergenic
1202207373 Y:22421349-22421371 GTCTCTCAGCCAAATGAATGTGG + Intergenic