ID: 1160556875

View in Genome Browser
Species Human (GRCh38)
Location 18:79731133-79731155
Sequence ATGTGTCCCCAGGATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160556875_1160556888 17 Left 1160556875 18:79731133-79731155 CCCTCTTCATCCTGGGGACACAT 0: 1
1: 0
2: 0
3: 20
4: 221
Right 1160556888 18:79731173-79731195 CGTTTTGGGGCACAGACGATGGG 0: 1
1: 0
2: 1
3: 77
4: 756
1160556875_1160556890 28 Left 1160556875 18:79731133-79731155 CCCTCTTCATCCTGGGGACACAT 0: 1
1: 0
2: 0
3: 20
4: 221
Right 1160556890 18:79731184-79731206 ACAGACGATGGGGAGTCAAGAGG 0: 1
1: 0
2: 1
3: 10
4: 122
1160556875_1160556885 3 Left 1160556875 18:79731133-79731155 CCCTCTTCATCCTGGGGACACAT 0: 1
1: 0
2: 0
3: 20
4: 221
Right 1160556885 18:79731159-79731181 GTGGGGCTGCTGCTCGTTTTGGG 0: 1
1: 0
2: 0
3: 9
4: 134
1160556875_1160556884 2 Left 1160556875 18:79731133-79731155 CCCTCTTCATCCTGGGGACACAT 0: 1
1: 0
2: 0
3: 20
4: 221
Right 1160556884 18:79731158-79731180 GGTGGGGCTGCTGCTCGTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 180
1160556875_1160556887 16 Left 1160556875 18:79731133-79731155 CCCTCTTCATCCTGGGGACACAT 0: 1
1: 0
2: 0
3: 20
4: 221
Right 1160556887 18:79731172-79731194 TCGTTTTGGGGCACAGACGATGG 0: 1
1: 0
2: 0
3: 7
4: 148
1160556875_1160556886 4 Left 1160556875 18:79731133-79731155 CCCTCTTCATCCTGGGGACACAT 0: 1
1: 0
2: 0
3: 20
4: 221
Right 1160556886 18:79731160-79731182 TGGGGCTGCTGCTCGTTTTGGGG 0: 1
1: 0
2: 2
3: 15
4: 168
1160556875_1160556889 18 Left 1160556875 18:79731133-79731155 CCCTCTTCATCCTGGGGACACAT 0: 1
1: 0
2: 0
3: 20
4: 221
Right 1160556889 18:79731174-79731196 GTTTTGGGGCACAGACGATGGGG 0: 1
1: 0
2: 63
3: 640
4: 4577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160556875 Original CRISPR ATGTGTCCCCAGGATGAAGA GGG (reversed) Intronic
900568168 1:3345644-3345666 ATGTGTCACCGGGATGCAGCAGG + Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901627277 1:10631409-10631431 CTGTGTTCCCAGCATTAAGAAGG - Intergenic
902190840 1:14762087-14762109 CTGTGTCCTCAGGATGACGGTGG + Intronic
902212906 1:14916571-14916593 ATGTGGCCCCTGGATAAGGAAGG + Intronic
902420423 1:16274968-16274990 ATGTGACACCAGTATGAACATGG - Intronic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902554612 1:17239632-17239654 ATGTAGCCCCAGGCTGAAGACGG + Intronic
907663210 1:56412520-56412542 TTGTTTCCCTAGGAGGAAGAGGG + Intergenic
908757199 1:67479784-67479806 AGGTGCACCCAGGATGGAGAGGG + Intergenic
909836023 1:80255887-80255909 TGGTTTCCCCAGGATAAAGAGGG + Intergenic
911230129 1:95352329-95352351 ACGTTTCACCAGTATGAAGATGG - Intergenic
912468291 1:109889131-109889153 ATGTTTTCCTAGGAAGAAGAGGG + Intergenic
914980618 1:152411386-152411408 ATGTTTCCCCATGATAAAGAGGG + Intronic
916475068 1:165161471-165161493 ATGTGATCCCAGGACCAAGATGG - Intergenic
916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG + Intronic
917087468 1:171318358-171318380 ATGTTTCACTAGGATGAACATGG + Intronic
918194820 1:182211457-182211479 GTGTTTGCCCAGGAAGAAGAGGG - Intergenic
918691356 1:187484053-187484075 ATTTGTTTCCAGGATGAATATGG - Intergenic
921427250 1:215018619-215018641 ATATGTGCACAGTATGAAGATGG + Intronic
922704071 1:227779797-227779819 ATGTGTCCCCTGGTTGCAGCAGG - Intronic
923492827 1:234499409-234499431 ATGTGTCCCCAGGAGGGGAAGGG - Intergenic
1063566479 10:7175563-7175585 ATGTGGCCCCCGTATCAAGAAGG + Intronic
1064161709 10:12952198-12952220 ATGTGACCTCAGGAGGGAGAAGG + Intronic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1069667416 10:70172149-70172171 CTGTGTCTCCAGGATGCACAAGG - Intergenic
1069773960 10:70916193-70916215 ATGTGTGCCCAGCGTGATGAGGG - Intergenic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1072414115 10:95232586-95232608 CTGTGTCCCCAAGAGGTAGACGG - Intergenic
1073902230 10:108235731-108235753 CTGTTTCCCAAGGAAGAAGATGG + Intergenic
1073917757 10:108426558-108426580 CTGTGTCCACAAGCTGAAGATGG + Intergenic
1075312714 10:121428284-121428306 AGGTGTCCCCAGGATAATGAGGG + Intergenic
1076322870 10:129596471-129596493 ATGTATCACCAAGATGAAGGCGG + Intronic
1077028978 11:455083-455105 ATGTGGGCTCAGGAAGAAGATGG - Intronic
1077733599 11:4764406-4764428 AAGTGTCCCCAGAATAGAGATGG + Intronic
1080086948 11:28294381-28294403 ATGTATCCCTGTGATGAAGACGG + Intronic
1080654233 11:34245965-34245987 TTGTGGCCCCAGGATGAGGAGGG - Intronic
1081705310 11:45179615-45179637 ATGTGTCCTCATGGTGGAGAGGG + Intronic
1085211488 11:74783774-74783796 ATGTGACCCCAGGAAGGAAAGGG + Intronic
1085729856 11:78987976-78987998 AGGTGTAGCCAGGTTGAAGATGG + Intronic
1086815906 11:91370393-91370415 ATGTGGGCCCAGAATGAGGAGGG + Intergenic
1089311240 11:117559726-117559748 AGGTGTCCCTGGGCTGAAGAAGG + Intronic
1090386284 11:126359205-126359227 ATCTGTCCCCATAATGAAAATGG + Intronic
1091553348 12:1553630-1553652 CTGTGGCCCCAGGAGGAAGCTGG + Intronic
1091620751 12:2086896-2086918 CTGTGACCCCAGGAAGAAAAAGG + Intronic
1093213865 12:16339931-16339953 TTGTGTACCAAGGATTAAGAAGG - Intergenic
1093721362 12:22446101-22446123 ATTTGACCCCAGGCTGAATAAGG - Intergenic
1095427264 12:42089828-42089850 AAGTGTAGCCAGGTTGAAGAAGG + Intronic
1095648322 12:44576484-44576506 ATGTCTCCCCAGGAATGAGATGG - Intronic
1098527201 12:71499723-71499745 CTGTTACCCCAGGAGGAAGAGGG + Intronic
1100714533 12:97291992-97292014 ATGTGCCCACAGGATGAACTGGG + Intergenic
1103595160 12:122020943-122020965 ATGCGCGCCCAGAATGAAGAGGG - Exonic
1107446292 13:40472739-40472761 GTGTGTCTCCAGGATGATGGTGG - Intergenic
1109410985 13:61969464-61969486 ATAAGTCCCCACGGTGAAGAAGG + Intergenic
1110290068 13:73795148-73795170 ATTTTTCCCCATGATAAAGATGG + Intronic
1110899313 13:80800617-80800639 CTCTGTCACCAGGATGAGGATGG + Intergenic
1113200814 13:107866556-107866578 ATGTGTCGGCAGTATGACGACGG - Exonic
1113201029 13:107867468-107867490 GTGTTTCTCCAGGACGAAGATGG - Intergenic
1113288921 13:108884360-108884382 ATGCATCCCAAGGATGAGGAAGG + Intronic
1113905403 13:113817243-113817265 ATGTGTCCCCTGGAGGGAGGGGG - Intergenic
1113905456 13:113817363-113817385 ATGTGTCCCCTGGAGGGAGGGGG - Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1115458279 14:33630726-33630748 ATGCCCCCCCAGGATGGAGAAGG + Intronic
1120379470 14:83756494-83756516 ATGTATTCCAAGGAAGAAGATGG - Intergenic
1122025433 14:98872551-98872573 ATCTGTCCCCGGCAGGAAGAAGG + Intergenic
1122699615 14:103579157-103579179 ATGTATCCCTCGGATAAAGAGGG - Intronic
1122972435 14:105157903-105157925 ATGTGGCCTGAGGATGAGGAGGG - Intronic
1124506323 15:30278382-30278404 ACGTGTCACCAGTATGAGGAAGG + Intergenic
1124737233 15:32260254-32260276 ACGTGTCACCAGTATGAGGAAGG - Intergenic
1127877468 15:63122973-63122995 ATATATCCCCAGGATAAGGAGGG - Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128657911 15:69476029-69476051 TTGTGTCCCCAGCATCCAGAAGG - Intergenic
1133741206 16:8652857-8652879 ATGTGTCCCCTGAATGGGGAAGG + Intergenic
1136072090 16:27793702-27793724 GTCTGTCCCCTGGATGCAGAGGG + Intronic
1137730311 16:50684646-50684668 CTGTGTCCCCCGCATGACGATGG - Intergenic
1138923258 16:61558399-61558421 ATTTGTCTCCAGGAAGAAAATGG + Intergenic
1140897864 16:79340970-79340992 ATGGGACCTCAAGATGAAGAGGG + Intergenic
1143095524 17:4476592-4476614 ATGTGGCCCCAGGAGGCAGCTGG + Intronic
1143645652 17:8228424-8228446 ATGGGTCCCTGGGAGGAAGAGGG - Intronic
1144263950 17:13550282-13550304 CTGTGTTCTCAGGAAGAAGAGGG - Intronic
1144967494 17:19087296-19087318 AGGTGGCCCCTGGATGAAGGAGG + Intergenic
1144980425 17:19164769-19164791 AGGTGGCCCCTGGATGAAGGAGG - Intergenic
1144987797 17:19213463-19213485 AGGTGGCCCCTGGATGAAGGAGG + Intergenic
1146625877 17:34435097-34435119 ATGTGTCCCCAGGTTGAATGTGG + Intergenic
1147614890 17:41821963-41821985 ATGTGTGCCCAGGAAAAAGCAGG - Intronic
1149963587 17:61139457-61139479 ATGTGTGCCCAGAATGCACAGGG - Intronic
1150181602 17:63127194-63127216 ATTTATCCCCAGAATGGAGAAGG - Intronic
1151006939 17:70448818-70448840 ATGTGTCAGCAGCATGAAAATGG - Intergenic
1153825435 18:8870051-8870073 TTGTGTCCCTAGGATTAGGAAGG - Intergenic
1158533273 18:58282962-58282984 AAGAGTCCCCAGGATGATGACGG + Intronic
1159216906 18:65404060-65404082 ATGTGTATCCAGGGTTAAGAAGG + Intergenic
1159564260 18:70031359-70031381 ATGTGTCCCCAGAAGGAGAAAGG - Intronic
1159813644 18:73046815-73046837 AAGTGTCCGCAGGATGACCAAGG - Intergenic
1160556875 18:79731133-79731155 ATGTGTCCCCAGGATGAAGAGGG - Intronic
1160973708 19:1781939-1781961 ATCTTACCCCAGCATGAAGAAGG + Intergenic
1162377777 19:10315482-10315504 ATCTGTCCCCAGGGTGAACGTGG - Exonic
1162476688 19:10904715-10904737 CTGTGTCCTCAGGATGATCAGGG - Intronic
1163352466 19:16786533-16786555 AAGTGTCCCCAACATAAAGATGG - Intronic
1164725769 19:30464771-30464793 ATGAGTGCCCAGGAGGGAGAGGG + Intronic
1165383376 19:35496075-35496097 CTGTGTTTCCAGGATGCAGAGGG - Intergenic
1165888834 19:39098788-39098810 ATGAGACCCCAGGATGAAAACGG + Intronic
1166785051 19:45362675-45362697 CTGTGTCCCCAGCATGAAGCAGG + Intronic
1167716461 19:51145350-51145372 ATGTGTCCCCAGAATCAACCAGG + Intronic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
926454749 2:13052831-13052853 GTGTGGCCCCAGCATGAACAAGG - Intergenic
928166681 2:28977267-28977289 AGGTGCCCCCAGGCTAAAGATGG - Intronic
928446385 2:31337161-31337183 ATGTGTCCCCAGTATCAGAATGG + Intronic
929747169 2:44670981-44671003 ATCTGTACCCAGGATTGAGAAGG - Intronic
936042749 2:109162034-109162056 ATGTGTCCTCAGGATCTAGAGGG + Intronic
937305583 2:120868567-120868589 AAGTGTCCCCAGGAGGGAGGGGG - Intronic
937353400 2:121183064-121183086 GAGTGTCCCCAGGATGCACAAGG + Intergenic
938321864 2:130371339-130371361 TGGTGTTCCAAGGATGAAGAAGG - Intronic
938779950 2:134575923-134575945 AGGTGAGCCCAGGATGCAGAAGG + Intronic
941187347 2:162333493-162333515 ATGAGTTCTAAGGATGAAGAGGG - Intronic
941272976 2:163453702-163453724 ATGTTCCCCCTGGCTGAAGAGGG + Intergenic
941493912 2:166177328-166177350 GTGTGTGCCCAGAATGAAAAAGG - Intergenic
941617349 2:167735875-167735897 ATGAATCCACATGATGAAGAAGG + Intergenic
945328316 2:208509567-208509589 ATGTGTACACTGGATAAAGAAGG - Intronic
947274648 2:228376545-228376567 ATGTTTCCCCCATATGAAGAGGG - Intergenic
947796053 2:232894698-232894720 ATGTGCCCTGGGGATGAAGAAGG + Intronic
948223334 2:236290364-236290386 ATATGTGCTCAGGAGGAAGAGGG + Intergenic
1170136106 20:13075288-13075310 ATGTGTCACTAGGAGGGAGAAGG - Intronic
1171312455 20:24155679-24155701 ACGTGCTCCCACGATGAAGATGG + Intergenic
1172547233 20:35771670-35771692 ATCTCTCTCCAAGATGAAGATGG - Intergenic
1175400427 20:58697035-58697057 ATGAGGCCACAGGATGCAGAGGG - Intronic
1176076916 20:63252846-63252868 ATGTGACCTCAGGGTGCAGAGGG - Intronic
1176155348 20:63617324-63617346 CTGTGTCCTCATGATGGAGAGGG - Intronic
1177257445 21:18683766-18683788 ATGCGCTCCCAGGAAGAAGATGG + Intergenic
1178077419 21:29024695-29024717 ATTCGTCACCAGGAGGAAGACGG + Exonic
1179047294 21:37857329-37857351 CTATGCCCCCAGGATGAAGAAGG - Intronic
1180611531 22:17101329-17101351 GGGTGGTCCCAGGATGAAGAAGG - Intronic
1181075904 22:20376600-20376622 CTCTGTCCCCAGGCTGGAGAGGG - Intronic
1181081695 22:20419789-20419811 ATTTGTCCCCAGTGGGAAGATGG - Intergenic
1181992346 22:26847088-26847110 TTCAGTCCCTAGGATGAAGATGG - Intergenic
1182856776 22:33524496-33524518 ATGTGGCCCCAGGATTGAGTTGG - Intronic
950118258 3:10464989-10465011 ATTTGGCCCAAGGATGAAGGTGG - Intronic
950145600 3:10647569-10647591 ATCTGTCCCCAGCAAGGAGATGG + Intronic
950368117 3:12503685-12503707 CTCTGTCCCCAGGATGCAGGAGG - Exonic
952386378 3:32844292-32844314 ATGTTGCCCTAGGAGGAAGAGGG + Intronic
953744581 3:45564554-45564576 ATGTGGCCAAAGCATGAAGAAGG - Intronic
954725846 3:52609490-52609512 ATGAGTCATCAGGATGATGAGGG - Exonic
957347386 3:78979682-78979704 ATCTGTCCCCAGAGTGCAGAGGG + Intronic
959470382 3:106742740-106742762 ATGTGTCCTCAGATGGAAGAAGG + Intergenic
959776645 3:110172507-110172529 ATGTTTCCCAAGGAGGGAGATGG + Intergenic
960190673 3:114701416-114701438 ATGTGCCACCATGATGTAGAGGG + Intronic
960354734 3:116637289-116637311 ATTTGTCACCATGAGGAAGAAGG + Intronic
961393213 3:126568995-126569017 CTGTGTCCCCTGGAGGCAGAGGG + Intergenic
961574111 3:127821237-127821259 ATGTGTCACCAGGAAGAAAGGGG - Intronic
962696121 3:137948981-137949003 GTGTGTCCCTAGGAGGGAGATGG + Intergenic
968790990 4:2661740-2661762 CTGTGTGCCCAGGCTGAAGATGG + Intronic
971266901 4:25103647-25103669 AACTGGCCCCAGGATGAGGAAGG - Intergenic
974855655 4:67457667-67457689 ATGTCCCCCTAAGATGAAGAAGG + Intergenic
975373362 4:73613546-73613568 ATCTGGACCCAGGAGGAAGAAGG - Intronic
976125495 4:81829813-81829835 CTGTGTCTCCAGGCTGCAGATGG - Intronic
977959637 4:103071412-103071434 CTCTGTCACCAGGCTGAAGAGGG + Intronic
978979861 4:114929995-114930017 ATGTAGCCCCAGAATGAAAAGGG + Intronic
981527354 4:145720080-145720102 TTGTGGCCCCAGAATGAAGGTGG + Intronic
982212906 4:153055319-153055341 ATCTGGCCGCAGGAGGAAGAGGG + Intergenic
982502485 4:156174177-156174199 ATGTGACCACAGCAAGAAGATGG - Intergenic
982518394 4:156381610-156381632 ATGGCTTCCCAGGATGAGGAAGG + Intergenic
985299137 4:188469217-188469239 ATGTGGCCCCATGATTAAGATGG + Intergenic
986308458 5:6532906-6532928 TCCTGTCCCCAGGATGCAGAAGG - Intergenic
987285519 5:16452328-16452350 ATGTGTCTGCTGGATGAAGCTGG - Intronic
987586551 5:19863697-19863719 CAGTGGCCCCAGGATGCAGAAGG + Intronic
987748417 5:22007716-22007738 ATGGTTTCCCAGGAAGAAGATGG + Intronic
990278569 5:54225920-54225942 ATGGGACCCCAGGGTGAAGAAGG + Intronic
991577101 5:68115966-68115988 CTGTGTATCCAGGATGGAGAAGG + Intergenic
991768593 5:70017503-70017525 ATGGTTTCCCAGGAAGAAGATGG + Intergenic
991847831 5:70892585-70892607 ATGGTTTCCCAGGAAGAAGATGG + Intergenic
992237017 5:74720326-74720348 ATGTTGCCCTAGGATAAAGATGG + Intronic
993106275 5:83604510-83604532 CTGTGTCTCCAGGTTGTAGATGG + Intergenic
993495656 5:88605818-88605840 ATGTCTTCCAAGGATGCAGAAGG + Intergenic
993945710 5:94115040-94115062 TTGTGTCCCCAGCATCTAGATGG - Intergenic
995429635 5:112059503-112059525 ATCATTTCCCAGGATGAAGAAGG + Intergenic
999196183 5:149783128-149783150 ATGTGGCCCAGGGGTGAAGAAGG - Intronic
1001738155 5:174023850-174023872 GTGTGGTTCCAGGATGAAGAAGG - Intergenic
1002141461 5:177143038-177143060 ATATGTCCCCAGTAAAAAGAAGG - Intronic
1004181147 6:13381493-13381515 AAGCATCCCCAGGATGTAGAAGG - Intronic
1004251654 6:14027881-14027903 ATCTGTCCCCAAGAAGATGAGGG + Intergenic
1005812619 6:29528952-29528974 TTGTGACACCAGGATGCAGAAGG - Intergenic
1007621267 6:43216210-43216232 ATGAGCCCCCAGGAAGTAGAAGG + Exonic
1010329243 6:74603014-74603036 ATATTTCCTGAGGATGAAGAAGG - Intergenic
1013615872 6:111842525-111842547 ATGTGTCTCCAGTGTGAATAGGG - Intronic
1015060280 6:128956124-128956146 ATGGAGCCACAGGATGAAGATGG + Intronic
1015229868 6:130902197-130902219 AAGTGTCCACAGGACTAAGATGG - Intronic
1015437918 6:133211323-133211345 ATTTTTCCCCATGATGAACAAGG - Intergenic
1016381205 6:143482857-143482879 ATGTGACCTCAAGATGGAGAAGG + Intronic
1018705677 6:166461823-166461845 ATGGGTCCCCAGGATGATGGAGG - Intronic
1020259290 7:6521642-6521664 CTGTGTCCCCAGCATGGAGCTGG + Intronic
1020711145 7:11606852-11606874 ATTTGTCCCAAGAATGAAAATGG + Intronic
1021623640 7:22571992-22572014 ATGTGGGCCCAGGAGGAAGAAGG + Intronic
1022209659 7:28195962-28195984 ATGTGGCCCCAGGAGGGAGGAGG - Intergenic
1022800901 7:33776358-33776380 ATGTATCCCCAGGAGCCAGAAGG - Intergenic
1022825966 7:34014214-34014236 ATGTGTCCCCACATTAAAGAGGG - Intronic
1023593117 7:41799758-41799780 TTGTGTGCCCATGATGAAGAGGG - Intergenic
1024557477 7:50615773-50615795 ATGTATCCCCAGTGAGAAGAAGG - Intronic
1025109209 7:56198883-56198905 ATGTGTGCCTAGTCTGAAGATGG - Intergenic
1026308516 7:69164081-69164103 ATGTGTGCCTAGTTTGAAGATGG + Intergenic
1026680746 7:72464791-72464813 ATCTGTCCCCAGGACTAAAAAGG - Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1031258278 7:119483998-119484020 ATGTTTCCACAGTAAGAAGAAGG + Intergenic
1032032741 7:128498024-128498046 GTGTCTCCACAGGATGCAGAAGG + Exonic
1032802780 7:135329741-135329763 CTGTGTCCCCACAAAGAAGAGGG - Intergenic
1033004768 7:137549471-137549493 GTGTGTTCCCAGTAAGAAGAAGG - Intronic
1033425984 7:141244759-141244781 ATGTGTTTCCAGGATGAAAGAGG + Intronic
1033547344 7:142413400-142413422 GTGTGTCCCCTGGAAGAAGGTGG + Intergenic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1034284955 7:149878544-149878566 CTGTGTTCCCAGGGTGAAGAAGG - Intronic
1034285049 7:149878908-149878930 CTGTGTTCCCAGGGTGACGAAGG + Intronic
1035004001 7:155641790-155641812 ATGTTTCCAAAGGATCAAGAAGG - Intronic
1035761785 8:2073825-2073847 ACGTAGCCCGAGGATGAAGAGGG + Intronic
1036961131 8:13245534-13245556 ATGTGTTCCCAGGAGGCACAAGG - Intronic
1037266599 8:17069215-17069237 AGGTCTCTCTAGGATGAAGAAGG - Intronic
1039355991 8:36816245-36816267 ATGTGTTCCCAGGAGGAAAATGG + Intronic
1039410626 8:37352286-37352308 ATGTGGCTCCAGGAGGAGGAGGG + Intergenic
1039552907 8:38456072-38456094 ATGTGTCCTCTGGATGGAGTTGG - Intronic
1039702991 8:39980344-39980366 ATGTGTCCCCTGGGGAAAGAAGG - Intronic
1041695468 8:60731516-60731538 ACGTATCCCCAGGATGAAGGGGG + Intronic
1048321421 8:133403606-133403628 AGGGTTCCCCAGGATGAGGATGG + Intergenic
1048405568 8:134116683-134116705 ATGGGTCCCCTGAGTGAAGACGG + Intergenic
1048614629 8:136059668-136059690 TTCTGTCCCCAAGATGGAGAGGG + Intergenic
1048997161 8:139801225-139801247 AAGTCTCCCCAGGAAGAGGAAGG - Intronic
1049807310 8:144546872-144546894 AGGTGCCCCCAGGATGAGGAAGG + Intronic
1050570026 9:6928169-6928191 ATGTGTTGCAAGGATGGAGAGGG - Intronic
1051135103 9:13911186-13911208 AGGTGACCTCAGAATGAAGAAGG - Intergenic
1051154566 9:14126483-14126505 CAGTCTCCCCAGGATGAGGAAGG + Intronic
1053485987 9:38456669-38456691 AAGTGTTTCCAGCATGAAGATGG + Intergenic
1056453017 9:86734838-86734860 ATGTTGCCCCAGCAGGAAGAGGG - Intergenic
1057024845 9:91726929-91726951 TTGTTTCCCCAGGATGCAGCCGG - Intronic
1059837084 9:118167516-118167538 ATATATCCCCAGAATGAAAAAGG - Intergenic
1186612333 X:11149778-11149800 ATGCTCCCCCAGAATGAAGAAGG + Intronic
1186739573 X:12503314-12503336 TTGTGTACACAGGATGAAGGTGG - Intronic
1189142895 X:38625336-38625358 CTGTGTGCCTAGGAAGAAGATGG - Intronic
1192069080 X:67918131-67918153 ATGTGTCCCTAGGAGGATTACGG + Intergenic
1192532846 X:71903969-71903991 ATGTTGACCCAGGATGGAGAAGG + Intergenic
1193479474 X:82010117-82010139 GTGTTTCCCCAGGAAGAACATGG - Intergenic
1193789560 X:85801295-85801317 ATGAGTCCATAGGAAGAAGATGG - Intergenic
1197601976 X:128542330-128542352 CTGTGTCGCCAGGCTGAAGCTGG + Intergenic
1197709685 X:129656523-129656545 CTGGGTCTCAAGGATGAAGAGGG - Intergenic
1197775770 X:130117867-130117889 ATGTGTCCTCAGAGTGAAGCTGG + Intergenic
1201588870 Y:15591728-15591750 ATGACTCCCCAGAATCAAGATGG - Intergenic
1201610735 Y:15840246-15840268 ATGTGGCCACAGGATGGGGATGG + Intergenic