ID: 1160558521

View in Genome Browser
Species Human (GRCh38)
Location 18:79741296-79741318
Sequence CCTTTTATGCTTTTGGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 306}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160558512_1160558521 8 Left 1160558512 18:79741265-79741287 CCCCGTGCGGTTGATCTCTCCCT 0: 1
1: 3
2: 4
3: 3
4: 62
Right 1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG 0: 1
1: 0
2: 0
3: 22
4: 306
1160558511_1160558521 9 Left 1160558511 18:79741264-79741286 CCCCCGTGCGGTTGATCTCTCCC 0: 1
1: 2
2: 2
3: 1
4: 27
Right 1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG 0: 1
1: 0
2: 0
3: 22
4: 306
1160558513_1160558521 7 Left 1160558513 18:79741266-79741288 CCCGTGCGGTTGATCTCTCCCTG 0: 1
1: 3
2: 3
3: 4
4: 78
Right 1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG 0: 1
1: 0
2: 0
3: 22
4: 306
1160558514_1160558521 6 Left 1160558514 18:79741267-79741289 CCGTGCGGTTGATCTCTCCCTGA 0: 1
1: 4
2: 2
3: 5
4: 93
Right 1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG 0: 1
1: 0
2: 0
3: 22
4: 306
1160558509_1160558521 27 Left 1160558509 18:79741246-79741268 CCTGTGGTTGGGTGAGGTCCCCC 0: 1
1: 1
2: 1
3: 6
4: 101
Right 1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG 0: 1
1: 0
2: 0
3: 22
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160558521 Original CRISPR CCTTTTATGCTTTTGGTGGC CGG Intronic
900904237 1:5539867-5539889 CCTTGTCTGGTTTTGGTGGCAGG + Intergenic
901187272 1:7382723-7382745 CCTTTTATTCTTTTGCCTGCAGG - Intronic
903426088 1:23255441-23255463 CCTCTTCAGCTTTTGGTAGCTGG - Intergenic
904917989 1:33984153-33984175 CCTTTTTTTTTTTTGGTGGGGGG - Intronic
905282535 1:36858406-36858428 CCTTGTAAGCTTTGGATGGCAGG - Intronic
906593527 1:47051265-47051287 ACTTTTACACTGTTGGTGGCAGG + Intergenic
907696105 1:56730802-56730824 CCTTGTCTGCTTTTGGTATCAGG - Intronic
909244704 1:73265721-73265743 CCTTGTCTGCTTTTGGTATCAGG - Intergenic
909343495 1:74557954-74557976 CCTTTTACACTGTTGGTGGGAGG + Intergenic
909987152 1:82175032-82175054 CATTTTAAGCTTTTGGTTGATGG + Intergenic
911614472 1:99993404-99993426 TCTTTTTTCTTTTTGGTGGCAGG + Intronic
912394541 1:109331133-109331155 CCTTGTCTGGTTTTGGTAGCAGG - Intronic
914443508 1:147728414-147728436 CCTTTTATCCCTTTTGAGGCTGG + Intergenic
915665184 1:157437870-157437892 CCTCTTATGGTCTTGGGGGCTGG - Intergenic
916175351 1:162033531-162033553 CCTTCCTTGCTTTTGTTGGCAGG + Intergenic
916740121 1:167640215-167640237 CCTTTCATGGTTCTGGAGGCCGG + Intronic
916783563 1:168063478-168063500 GTTTTTATGCTTTTGGTTGGGGG + Intronic
918018371 1:180659840-180659862 CTTTTTCTGGTTTTGGTGTCAGG + Intronic
918396957 1:184123048-184123070 TGTGTTATGCTTTTGGTTGCTGG + Intergenic
918749623 1:188256783-188256805 CCTTTCCTGATTTTGGTGGTAGG + Intergenic
919823083 1:201484996-201485018 GCTTCTATAATTTTGGTGGCAGG - Intronic
920934459 1:210418219-210418241 CCTTCTTTGCTGGTGGTGGCTGG + Exonic
921303631 1:213773614-213773636 CATTTTATGTTTGTGGTGACTGG + Intergenic
922711507 1:227836994-227837016 TATTTTATTCTTTTAGTGGCAGG + Intronic
923716863 1:236432381-236432403 TTTTTTTTTCTTTTGGTGGCAGG - Intronic
924488312 1:244509552-244509574 CCTTGTCTGGTTTTGGTGTCAGG + Intronic
924511099 1:244729854-244729876 ACTTTTATGCTTTTGTTGACAGG - Intergenic
1063271498 10:4514619-4514641 TGTTTTCTGCTTTTAGTGGCAGG - Intergenic
1064910257 10:20393521-20393543 CCTTGTGTGCCTTGGGTGGCTGG + Intergenic
1065091358 10:22237287-22237309 CCTTTTCTGGTTTTGGTATCGGG + Intergenic
1066033708 10:31457278-31457300 CTCTGTATGCTTTTGGTGGTGGG + Intronic
1068810679 10:61252424-61252446 GCTTTTATACTGTTGGTGGGAGG - Intergenic
1068868467 10:61919044-61919066 CCTTTTATTTTTTTGGGGGGGGG - Intronic
1069089925 10:64187907-64187929 CCTGTTATGCTTTGTTTGGCGGG + Intergenic
1069395267 10:67980879-67980901 CATTATATGCTTTTGGTTTCAGG - Intronic
1069959564 10:72071831-72071853 ACTCTTATGCTCTTGGTGGGAGG - Intronic
1070522654 10:77267870-77267892 CCTTTTATGGTATTCTTGGCAGG - Intronic
1071433879 10:85628645-85628667 CCTTTCATTCTTTGGGTAGCAGG - Intronic
1071917792 10:90315372-90315394 CCTTTTATGCTTTTAGATGAAGG - Intergenic
1071968685 10:90879907-90879929 CATTTTATACTTTTGGCGGATGG - Intronic
1073031977 10:100533829-100533851 CCTTATATGCTTTTTTTGGGGGG + Intronic
1076187937 10:128463525-128463547 TATTTGATGCTTTTGGAGGCTGG + Intergenic
1076920243 10:133448141-133448163 CCTTGTCTGGTTTTGGTGTCAGG - Intergenic
1077682641 11:4258103-4258125 CCTTGTCTGGTTTTGGTGCCTGG + Intergenic
1077687394 11:4308634-4308656 CCTTGTCTGGTTTTGGTGTCCGG - Intergenic
1077692563 11:4359825-4359847 CCTTGTCTGGTTTTGGTGCCTGG - Intergenic
1079960750 11:26920245-26920267 CCTTTTCTTCTTTTGATGGAGGG - Intergenic
1080465180 11:32489545-32489567 CCTTTTTTGCTTTTTGAGACAGG + Intergenic
1081705029 11:45177765-45177787 CCCTTTATGCTTTGGCTGCCAGG + Intronic
1082073097 11:47955321-47955343 CCTTTTATGCTTATGGGCCCAGG - Intergenic
1082865148 11:57892897-57892919 CCTTGTCTGGTTTTGGTGTCAGG + Intergenic
1084434129 11:69128371-69128393 CTTTATATGCTTTTGTTGCCAGG - Intergenic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1086894911 11:92301077-92301099 CCTCATGTGCTTTTGGTGACGGG + Intergenic
1087737418 11:101850729-101850751 GCTTGTGTGCTTTTGGAGGCTGG - Intronic
1087794773 11:102444081-102444103 ACTTTTACGCTGTTGGTGGGAGG + Intronic
1091210854 11:133857866-133857888 CCTTGTCTGGTTTTGGTAGCAGG + Intergenic
1091768958 12:3139157-3139179 GCTGTTTTGCTTTTGGTGGGGGG + Intronic
1092195075 12:6544463-6544485 CCTTTTAAGCTATTTTTGGCTGG - Intronic
1092313644 12:7386484-7386506 CCTTTTCTGGTTTTGGTATCAGG - Intronic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1093214001 12:16341550-16341572 CCTTGTCTGCTTTTGGTATCAGG + Intergenic
1093485163 12:19644039-19644061 CCTTTTTTATTTTTGGTGGTTGG + Intronic
1095369186 12:41446057-41446079 CCTTTTAAGCTTTTTGTTGAGGG - Intronic
1096342461 12:50812980-50813002 CCTTTTATGCTTTGGCTACCAGG - Intronic
1097846621 12:64373154-64373176 ACTTTTATGTTTTTGGTTCCTGG + Intronic
1098687021 12:73434594-73434616 CATCTTATGCTGATGGTGGCAGG + Intergenic
1099191775 12:79568646-79568668 CCTTTTACTGTTTTGGTGGGTGG - Intergenic
1100025099 12:90118639-90118661 CCTTTTCTGGTTTTGGTATCAGG + Intergenic
1100951604 12:99856548-99856570 CCTTTTCTGGTTTTGGTGTTAGG - Intronic
1101511285 12:105394676-105394698 CCTTTCTAGCTTTTGGTGGTTGG - Intronic
1102057379 12:109906892-109906914 TCTTTTTTTCTTTTGGAGGCAGG + Intronic
1106114362 13:26804190-26804212 AATTTTATGCTTTTGGTTGCTGG - Intergenic
1108321075 13:49291096-49291118 TGTTTTATGTTTTTGGTGGGGGG - Intronic
1109841090 13:67917227-67917249 GCTTATATGCTTTTGGTATCAGG - Intergenic
1110907618 13:80912282-80912304 GCTTTTATACTGTTGGTGGGAGG - Intergenic
1111465212 13:88599361-88599383 CCATTTATGTTTTTGGTGGAGGG + Intergenic
1112056942 13:95698181-95698203 CCTTGTGTACTTTTGTTGGCAGG + Intronic
1112166341 13:96924244-96924266 GCTTTTATGCTGTTGGTGGGAGG + Intergenic
1112609019 13:100937797-100937819 GCTTATATGCTGTTGGAGGCAGG - Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1114242127 14:20877727-20877749 CCTCTTAGGTTTTTTGTGGCTGG + Intergenic
1114248997 14:20941343-20941365 CCTTTTAGGTTTTTTGTGGCTGG + Intergenic
1114524040 14:23357158-23357180 CCCTTTAGGCCTTGGGTGGCTGG - Exonic
1117744684 14:58856874-58856896 CCTTTTCTGGTTTTGGTACCAGG + Intergenic
1119297502 14:73545062-73545084 CCTTTTTTTTTTTTGGAGGCAGG + Intronic
1119536549 14:75407681-75407703 GCTTTTATACTGTTGGTGGCAGG - Intergenic
1120139222 14:80909413-80909435 ACTTTTTTTCTTTTGGTGGCAGG - Intronic
1120448488 14:84633557-84633579 CCTTTTATGGTAATGCTGGCTGG - Intergenic
1121094168 14:91204421-91204443 CGTTCTATGCTCTTGGTGCCAGG - Intronic
1121573206 14:94962836-94962858 CATTTTTTGCTGGTGGTGGCGGG - Intergenic
1122004127 14:98688169-98688191 CAATTGTTGCTTTTGGTGGCTGG - Intergenic
1123576123 15:21671090-21671112 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1123612744 15:22113564-22113586 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1124857723 15:33406954-33406976 TCTCTTATGGTTTTGGAGGCTGG + Intronic
1126169193 15:45680415-45680437 TCTTTTTTTCTTTTGGAGGCAGG + Intronic
1126816075 15:52455474-52455496 CCTTTTCTGATTTTGGTATCAGG - Intronic
1127156143 15:56127033-56127055 CTTTTTGTGCTATTGTTGGCTGG - Intronic
1129068379 15:72930117-72930139 CCTTTTCTGATTTTGGTATCAGG + Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130248477 15:82276810-82276832 CCTTTAATGCTTTTTGTAGAAGG - Intronic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1202984991 15_KI270727v1_random:405335-405357 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1133107331 16:3520990-3521012 CCTTTTTGGATGTTGGTGGCTGG + Intronic
1133579125 16:7126082-7126104 TTTTTTATTCTTTTGGTGGGGGG - Intronic
1138249473 16:55490933-55490955 TCTTTCATGCTTCTGGAGGCTGG + Intronic
1138738914 16:59284409-59284431 CCTTGTCTGGTTTTGGTAGCAGG - Intergenic
1138881306 16:61018042-61018064 CCTTTCCTGGTTTTGGTGCCAGG - Intergenic
1139024114 16:62792560-62792582 CTTTTTCTGCTTTTGGTATCAGG + Intergenic
1140116301 16:72044325-72044347 GCTTTTATGCTTCTGAGGGCTGG + Intronic
1140730833 16:77854377-77854399 TCTTTGCTGCCTTTGGTGGCAGG + Intronic
1140838898 16:78820740-78820762 TGTTTCATGGTTTTGGTGGCCGG + Intronic
1141457317 16:84151943-84151965 CATTGTATGCTGTTGGTGTCTGG + Intronic
1144938808 17:18922155-18922177 ACTTCATTGCTTTTGGTGGCTGG + Intronic
1145753403 17:27371915-27371937 CCTTTTGTATTTTTGGTGTCAGG + Intergenic
1147903623 17:43807952-43807974 CCTTTTATTTTTTTGGGGACAGG - Intronic
1149452831 17:56763357-56763379 AATTTTGTGCTTTTGGTGCCTGG - Intergenic
1151835430 17:76579848-76579870 CCTCTTATGGTTCTGGAGGCTGG - Intronic
1153012563 18:552798-552820 CCTTTTGTGGTTTTGGGGGATGG - Intergenic
1153269049 18:3300869-3300891 CCTTTTCTGGTTTTGGTATCAGG - Intergenic
1153511072 18:5853292-5853314 CCTTTTCTCCTCTTGCTGGCTGG - Intergenic
1153714464 18:7832637-7832659 CCATTTTGGCTTTTGGTTGCTGG + Intronic
1154079792 18:11244884-11244906 TTTTTTATGATTTTGGAGGCTGG + Intergenic
1156929074 18:42618939-42618961 CCTTCTATGCTTTTGCTGAATGG + Intergenic
1157078290 18:44492749-44492771 CATCTTATGTGTTTGGTGGCGGG - Intergenic
1157846976 18:51013118-51013140 CTTTTTCAGCTTCTGGTGGCTGG + Intronic
1157974010 18:52305377-52305399 CCTTATTTGCTTTTGGTGTCAGG - Intergenic
1159610483 18:70519776-70519798 TCTTTTAAGTTTTTGGTGGCTGG + Intergenic
1159612579 18:70542765-70542787 CCTTTCTTGGTTTTGGTGGTAGG + Intergenic
1159750424 18:72293900-72293922 CCATTTTTGCTTTGGGTGCCTGG + Intergenic
1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG + Intronic
1163463921 19:17455299-17455321 CCTTTTGTGTTTTTGGGGACAGG + Intronic
1165017776 19:32895140-32895162 CCTTGTCTGGTTTTGGTAGCAGG - Intronic
1166216847 19:41341526-41341548 CTTTTTTTGTTTTTTGTGGCTGG + Intronic
1166622918 19:44319526-44319548 CCTTTTCTGGTTTTGGTATCAGG + Intergenic
1168389792 19:55997428-55997450 CCTTTTCTGGTTTTGGTATCAGG + Intergenic
926662529 2:15483128-15483150 GCTTTTATGTTGTTGGAGGCAGG - Intronic
927081314 2:19633620-19633642 CCTTTGGTCCTTCTGGTGGCTGG - Intergenic
927627060 2:24732904-24732926 CCTTTTTTTCTTTTTTTGGCGGG - Intronic
931009758 2:57896798-57896820 CTTTTTATTTTTTTGGTGGTGGG - Intergenic
931344968 2:61438017-61438039 CCTTTTCTGGTTTTGGTATCAGG - Intronic
933296339 2:80495472-80495494 CCTTTTCTTTTTTTGGTGGTTGG - Intronic
933581894 2:84136463-84136485 CCTTTTAGACTTGTGATGGCTGG - Intergenic
935541741 2:104356396-104356418 CCTTGTCAACTTTTGGTGGCCGG - Intergenic
935752019 2:106244042-106244064 CTTTTTCTGGTTTTGGTGTCAGG - Intergenic
935912429 2:107911589-107911611 CTTTTTCTGGTTTTGGTGTCAGG - Intergenic
936417970 2:112336842-112336864 TATTTTATGCTTTTGGAGACAGG + Exonic
936838283 2:116735675-116735697 CCTTGTCTGATTTTGGTGTCAGG - Intergenic
938728141 2:134124829-134124851 CCCTTTGTGATTTTTGTGGCTGG + Intronic
939175719 2:138745474-138745496 CCTTTTCTTCTTTTTTTGGCGGG + Intronic
940716355 2:157229422-157229444 CCTTGTCTGGTTTTGGTGTCAGG + Intergenic
940835375 2:158515507-158515529 AATTTCATGTTTTTGGTGGCAGG + Intronic
941123965 2:161563650-161563672 CCTTGTCTGCTTTTGGTATCAGG + Intronic
942547999 2:177084430-177084452 CCTTTTATATTTTAGGTGGGGGG + Intergenic
944144632 2:196493817-196493839 CCTTTTATGCTATTGGAAACTGG + Intronic
944178384 2:196859530-196859552 TATTTTATGGTTTTGGTGTCAGG - Intronic
944419563 2:199515078-199515100 GCTTTTATACTATTGGTGGGAGG + Intergenic
945362673 2:208910510-208910532 CCTTTTCTGGTTTTGGTGTTAGG - Intergenic
946076346 2:217076867-217076889 CATTTTATGCTGTTGGTGACAGG + Intergenic
946748561 2:222870129-222870151 CCTTTCTTGCTTTTGGGGGATGG + Intronic
946972509 2:225110760-225110782 CCTTTTATTCTTTTACTTGCTGG + Intergenic
947877205 2:233475501-233475523 CCTTAGCTGCTTTTGGTTGCCGG - Exonic
1168966296 20:1900401-1900423 GCTTTTATGCTGTTGGGGGATGG + Intronic
1169783374 20:9332696-9332718 CCTTTTTTGCTTTTGTTGCTGGG + Intronic
1170514255 20:17111577-17111599 AATTTTATTCTTTTTGTGGCAGG + Intergenic
1172928004 20:38558273-38558295 TCCTTTCTTCTTTTGGTGGCAGG + Exonic
1173752859 20:45490331-45490353 CCTCTTAAGCTTCTGGTGGAGGG - Intergenic
1176815082 21:13592169-13592191 CCTTTTACACTGTTGGTGGGAGG + Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1177276963 21:18924434-18924456 CATTTTATGCTTTAAGTGGAGGG + Intergenic
1177817690 21:25996022-25996044 CCATTTATGCTTATGATTGCTGG - Intronic
1178147120 21:29752830-29752852 CTTTTTATTTTTTTGGAGGCAGG - Intronic
1178612017 21:34091327-34091349 CCTTGTTTGGTTTTAGTGGCAGG + Intronic
1179175517 21:39005168-39005190 GCTTTTATGCTTTCAGAGGCAGG + Intergenic
1180113736 21:45681726-45681748 TCTTTTTTGGTTTTGGTGTCAGG + Intronic
1181422072 22:22808714-22808736 CCTTGTTTGCCTTTGGTGTCAGG - Intronic
1182729977 22:32480673-32480695 CCTTTTTTTTTTTTGGTGACAGG + Intronic
1183357623 22:37368116-37368138 CCTTTTCTTCTTTTGGGGGTGGG - Exonic
1185117895 22:48948547-48948569 CCTTTTATGACTTTAGTGGGTGG + Intergenic
950514735 3:13457330-13457352 CTTTTTATGCTTTTTATGACTGG - Intergenic
952144386 3:30516040-30516062 TCTTTTATGATTGTGGAGGCTGG - Intergenic
952940026 3:38436584-38436606 CCTTTTCTGGTTTTGGTATCAGG - Intergenic
954168566 3:48780968-48780990 CTTTTTTTTCTTTTGGTGGTGGG + Intronic
958175043 3:89987063-89987085 CCTTATCTGGTTTTGGTGTCAGG - Intergenic
958677672 3:97287883-97287905 CCTTGTCTGATTTTGGTGTCAGG + Intronic
959259324 3:104054615-104054637 CTTTTTATGGTTTTGGTATCAGG - Intergenic
959949041 3:112158495-112158517 CCTTGTCTGCTTTTGGTATCAGG + Intronic
960249873 3:115440047-115440069 GCTTTTATGATTGTGGAGGCTGG + Intergenic
960320858 3:116233707-116233729 TCTTTTCTTTTTTTGGTGGCGGG - Intronic
962157289 3:132961418-132961440 CCTTTTACACTGTTGGTGGGAGG + Intergenic
962564081 3:136639327-136639349 CCTTTTTTCTTTTTGGTGACAGG - Intronic
962655293 3:137537856-137537878 TATTTTATTCTTTTTGTGGCTGG + Intergenic
963014228 3:140805744-140805766 CCTTTTTTGGTTTTGGTATCAGG + Intergenic
963217186 3:142761549-142761571 CCTTGTATGGTTTTGGTATCAGG + Intronic
963479627 3:145854516-145854538 CATTTTAAGCTTGTGTTGGCAGG - Intergenic
964325266 3:155538916-155538938 CCTTTTCTGGTTTTGGTGTTAGG - Intronic
966849901 3:184157930-184157952 CCTTTTATGCTTAGTGTGCCAGG + Intronic
967860844 3:194150381-194150403 CCTTATATGCTTTTAGTTACGGG - Intergenic
968187988 3:196646424-196646446 CCTTGCATGCTGGTGGTGGCTGG - Intronic
969650053 4:8460853-8460875 CCTTTTATTTTTTTGGAGACAGG + Intronic
971993729 4:33935699-33935721 CTTTTTATGCTTCTGGAGGCTGG - Intergenic
972058670 4:34838153-34838175 GCTTTTACGCTGTTGGTGGGAGG - Intergenic
973140013 4:46754957-46754979 CCTTGTATGATTTTGCTGTCAGG - Intronic
974637756 4:64587746-64587768 TCTTTCATGCTTTTTGTGGTAGG - Intergenic
974825001 4:67116980-67117002 CCTTTTATACTGTTGGTGGGGGG + Intergenic
976584817 4:86784450-86784472 GGTTTTATGCTTTAGGTTGCTGG + Exonic
977432558 4:96949779-96949801 CCTTTTCTGTTTTTGGTATCAGG - Intergenic
977623956 4:99169640-99169662 CCTTTCATGATTTTGGTATCAGG + Intergenic
978627138 4:110699835-110699857 CCTTTTCTGGCTTTGGTGTCAGG + Intergenic
979388151 4:120094377-120094399 CCTTATCTGGTTTTGGTGTCAGG + Intergenic
979638551 4:122984931-122984953 CCTTTTCTGGTTTTGGTAGTAGG + Intronic
980579973 4:134736661-134736683 GCTTTTATACTATTGGTGTCAGG - Intergenic
981595862 4:146421019-146421041 CCTTTTTTGTTTTTGGAGACAGG - Intronic
982845168 4:160243456-160243478 CCTTTCCTGGTTTTGGTGTCAGG + Intergenic
983304917 4:165973544-165973566 CCTTTTATTGGTTTAGTGGCTGG + Intronic
983550416 4:169011565-169011587 CCTTTGTTGCTTTCGCTGGCAGG - Intergenic
983882620 4:172950486-172950508 CCTTGGGTGCTTTTGGTGGACGG - Intronic
984639067 4:182143660-182143682 CCTTTTCTGCTGCGGGTGGCGGG - Intergenic
986182743 5:5408788-5408810 TCTTTTATGGTTTCGATGGCAGG + Intergenic
987102713 5:14606179-14606201 CATTTTATGTGGTTGGTGGCAGG + Intronic
987618764 5:20311180-20311202 GCTTTTACACTTTTGGTGGGAGG + Intronic
988607974 5:32697465-32697487 CTTTTTCTGGTTTTGGTGTCAGG + Intronic
988661690 5:33277210-33277232 CCTTTTGTGCATCTGTTGGCAGG + Intergenic
992739178 5:79755791-79755813 CCTTTAATGCTTTTGGGGGAAGG + Intronic
993036921 5:82769100-82769122 CCTTTTAGGCTTGTGATGGGAGG - Intergenic
993455148 5:88119586-88119608 CCTTTTATATTTTTGGAGGATGG - Intergenic
994896064 5:105704568-105704590 CCTTTTCTGATTTTGGTATCAGG - Intergenic
996207873 5:120764534-120764556 CCTTTTCTGATTTTGGTGTCAGG + Intergenic
997634605 5:135395949-135395971 CCTGTTATGTTTTCAGTGGCAGG + Intronic
998705712 5:144757577-144757599 CCTCTTGTGCTTTTGGTAGTGGG + Intergenic
1000292612 5:159884545-159884567 TTTTTTATGGTTTTGGAGGCTGG - Intergenic
1000952680 5:167503516-167503538 CCTTTTTTTTTTTTGGTGGTTGG + Intronic
1001136725 5:169108638-169108660 CTTTTAATGCTCTTGGTGGATGG + Intronic
1003775509 6:9357605-9357627 CCTTGTCTGGTTTTGGTGTCAGG - Intergenic
1003807180 6:9738236-9738258 CCTGTTCTACTTTGGGTGGCAGG - Intronic
1004164309 6:13242099-13242121 CCTTTGCTGCTTTAGGTGACTGG - Intronic
1004340183 6:14801486-14801508 CCTTTTCTAGTTTTGGTGCCTGG - Intergenic
1005435439 6:25806042-25806064 CCTTTTCTGATTTTGGTATCAGG - Intronic
1006335695 6:33419362-33419384 CCTTTTATGCTTCTGGTTTGGGG + Intergenic
1007349870 6:41263295-41263317 CCTTTTCTGGTTTTGGTATCAGG - Intergenic
1008672339 6:53783433-53783455 CCTTGTCTGCTTTTGGTACCAGG - Intergenic
1009063143 6:58421263-58421285 GCTTTTATCCTTTTTGTGACTGG - Intergenic
1009250824 6:61295822-61295844 GCTTTTATCCTTTTTGTGACTGG - Intergenic
1009300940 6:62019421-62019443 CCTTTTCTGATTTTGGTATCAGG + Intronic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1009636708 6:66275396-66275418 CGTTTTATGCTTTTGATGTGAGG - Intergenic
1010023602 6:71190001-71190023 CCTTCTGTGCTTCTGGTGGGTGG - Intergenic
1010298985 6:74236717-74236739 CCTTTTCTGGTTTTGGTATCTGG + Intergenic
1010415543 6:75607292-75607314 CCTTTTTTTTTTTGGGTGGCAGG - Intronic
1011062368 6:83285254-83285276 GCTTTTATGCTTTTTGATGCAGG - Intronic
1014407974 6:121075160-121075182 CTTTTTTTGGTTTTGGTAGCAGG - Intergenic
1016000201 6:139033804-139033826 CCTTTTGTATTTTTGGTGCCTGG + Intronic
1016116617 6:140293463-140293485 CATTGTATGCTTTTGGTACCAGG - Intergenic
1016496779 6:144672133-144672155 CCTTTTCTGGTTTTGGTATCAGG + Intronic
1016746170 6:147582327-147582349 CCTTTTTTTTTTTTGGTGGGGGG - Intronic
1016787219 6:148024233-148024255 CCTTTTGTGCTTTTTGTACCTGG + Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1020430630 7:8113271-8113293 CCTTTTGTCCTCTTCGTGGCTGG - Exonic
1021529532 7:21628765-21628787 CCTTTTCTGCTTTTGGTATCAGG + Intronic
1022783355 7:33609699-33609721 ACATTTATGCTTCTGGTGCCAGG + Intergenic
1022890597 7:34693654-34693676 CCTTGTATGATTTTGGTATCAGG - Intronic
1022906090 7:34859000-34859022 TCTTTTTTGCTCTAGGTGGCAGG + Intronic
1023485168 7:40678477-40678499 CTTTTCTTTCTTTTGGTGGCTGG - Intronic
1023762284 7:43477009-43477031 CCTTTTTTGCTATTGTTGTCGGG - Intronic
1024641514 7:51332960-51332982 CTTTTTCTGCTTTTGGTGTAAGG - Intergenic
1024711176 7:52016652-52016674 CCTATTTTGCTTTTGGTTGAAGG - Intergenic
1024799611 7:53061029-53061051 CCTGTTGTGCTTTTCGGGGCTGG - Intergenic
1024832902 7:53482551-53482573 GCTTTTCTTCTTTTGGTGGATGG - Intergenic
1025018236 7:55459348-55459370 CCTTCTCTGGTTTTGGTGTCAGG + Intronic
1027520957 7:79206731-79206753 CATTGTCTGCTTTTGGTGTCAGG - Intronic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1029489657 7:100863619-100863641 CCTTTGTGGCTTTGGGTGGCGGG - Intronic
1030366128 7:108648422-108648444 CTTTTGATCCTTTTGGTTGCTGG + Intergenic
1031209744 7:118807604-118807626 TCTTTTCTCCTTTTGGTGTCTGG - Intergenic
1032930955 7:136669908-136669930 CCTTGTCTGGTTTTGGTGGAAGG + Intergenic
1033108390 7:138552539-138552561 TCTTTGATGATTTTGGTGGGGGG + Intronic
1033841694 7:145382613-145382635 CCTTGTTTGCTTTTGGTATCAGG + Intergenic
1033976665 7:147110982-147111004 GCTTTTATGCTGTTGGTGGGAGG - Intronic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1036001776 8:4613042-4613064 CTTGTTTTGCATTTGGTGGCTGG + Intronic
1037375941 8:18228293-18228315 CCTTTTCTGATTTTGGTTTCAGG - Intergenic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1039899567 8:41741422-41741444 ACTTTTAAGATTTTGGTGGCTGG + Intronic
1040924417 8:52662979-52663001 ACTTACATGCTTTTGGTGTCAGG - Intronic
1041432278 8:57795974-57795996 CCCTTTATTCTTTTGGAAGCAGG - Intergenic
1041471580 8:58215652-58215674 CCTTTTCTGGTTTTGGTATCAGG - Intergenic
1041630085 8:60077510-60077532 ACTTTTACACTTTTGGTGGGAGG - Intergenic
1042893209 8:73636002-73636024 ACTTTTCTGCATTGGGTGGCAGG - Intronic
1043650169 8:82581351-82581373 CCTTTTATGTTTTTGGTTGAAGG - Intergenic
1044767734 8:95594495-95594517 ACTTTTATACTGTTGGTGGGAGG - Intergenic
1045384539 8:101658630-101658652 CCTTTCATGCTTTGGGGAGCTGG + Intronic
1049094718 8:140541513-140541535 GCCTTTAGGCTTTTGGTGTCTGG + Intronic
1049515972 8:143056134-143056156 TCTTTTCTGTTTTTGGTGGTGGG + Intronic
1050391750 9:5150896-5150918 CATTTTATTCTTTTTATGGCTGG - Intronic
1051436603 9:17040248-17040270 CCTCTTTTGGTTTTTGTGGCAGG + Intergenic
1052141376 9:24989501-24989523 CCTTTTCTGGTTTTGGTGTTAGG - Intergenic
1055656688 9:78457261-78457283 CCTTTTCTGGTTTTGGTATCAGG - Intergenic
1055914206 9:81383988-81384010 CCTTTTTTGCTTTTGTTATCAGG + Intergenic
1059706457 9:116827904-116827926 CCTTGTATGGTTTTGGTATCAGG - Intronic
1060199001 9:121640958-121640980 CCTCTTAAGCCTTTGGTGACAGG + Intronic
1203532277 Un_GL000213v1:157261-157283 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1188864455 X:35298236-35298258 ATTTTTATGCTTTTGGTCTCAGG + Intergenic
1190589765 X:51988000-51988022 ACTTTTATACTGTTGGTGGGAGG - Intergenic
1191198904 X:57756539-57756561 CTTTTTCTGGTTTTGGTGTCAGG - Intergenic
1191647568 X:63498597-63498619 CTTTTTCTGGTTTTGGTAGCAGG - Intergenic
1192015789 X:67328890-67328912 TCTTCTATGCTTTTGGTTGAGGG + Intergenic
1193113251 X:77751137-77751159 ACTTTTACACTTTTGGTGGAAGG - Intronic
1193194525 X:78615743-78615765 CTTTTTCTGGTTTTGGTGTCAGG + Intergenic
1193324169 X:80160130-80160152 CCTTGTATAGTTTTGGTGTCAGG - Intergenic
1193674586 X:84434645-84434667 CATTTTATGCTTTTGGTATCAGG + Intronic
1194014452 X:88601966-88601988 TCTTTCCTGCTTTTGGTGTCAGG + Intergenic
1194176688 X:90658687-90658709 CCTTGTCTGGTTTTGGTGTCAGG + Intergenic
1194401399 X:93441256-93441278 CCTTGTCTGGTTTTGGTGTCAGG - Intergenic
1194492036 X:94563095-94563117 CTTTTTCTGGTTTTGGTGTCAGG + Intergenic
1194492122 X:94564967-94564989 CTTTTTCTGGTTTTGGTGTCAGG + Intergenic
1194546681 X:95243831-95243853 TCTTTTCTGGTTTTTGTGGCAGG - Intergenic
1195073278 X:101302144-101302166 CCTTGTCTGGTTTTGGTAGCAGG + Intergenic
1196563466 X:117177815-117177837 ACTTTTACCCTTTTGCTGGCAGG - Intergenic
1197402973 X:126015306-126015328 CTTTTTCTGCTTTTGGTATCAGG + Intergenic
1197485289 X:127042526-127042548 CCTTTTCTGGTTTTGGTGTTAGG - Intergenic
1199295820 X:146157492-146157514 TCTTTCATGGTTTTGGTGTCTGG - Intergenic
1200183906 X:154169473-154169495 TCTTTTATTCTTTTGGAAGCGGG - Intergenic
1200189560 X:154206601-154206623 TCTTTTATTCTTTTGGAAGCGGG - Intergenic
1200195313 X:154244410-154244432 TCTTTTATTCTTTTGGAAGCGGG - Intergenic
1200200965 X:154281531-154281553 TCTTTTATTCTTTTGGAAGCGGG - Intronic
1200915486 Y:8567703-8567725 TCTCTTAACCTTTTGGTGGCAGG + Intergenic
1201990422 Y:20018179-20018201 CCCTTTATGCTTTTGGTAGGGGG + Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic