ID: 1160560190

View in Genome Browser
Species Human (GRCh38)
Location 18:79751131-79751153
Sequence ACTCAGAGGCAGGCCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 2, 1: 0, 2: 1, 3: 48, 4: 448}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160560183_1160560190 -4 Left 1160560183 18:79751112-79751134 CCAGGGAGGGAGGGGCTGGACTC 0: 1
1: 0
2: 3
3: 69
4: 832
Right 1160560190 18:79751131-79751153 ACTCAGAGGCAGGCCGGGGAGGG 0: 2
1: 0
2: 1
3: 48
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160560190 Original CRISPR ACTCAGAGGCAGGCCGGGGA GGG Intronic
900087682 1:906169-906191 CCTCAGTGGCAGCCCCGGGAGGG + Intergenic
900173312 1:1281102-1281124 ACTCTGAGTCAGCCCTGGGACGG - Intronic
900210740 1:1454686-1454708 ACACCGAGGCAGACAGGGGAAGG - Intronic
900216617 1:1485356-1485378 ACACCGAGGCAGACAGGGGAAGG - Intronic
900223698 1:1523084-1523106 ACACCGAGGCAGACAGGGGAAGG - Intronic
900520742 1:3104426-3104448 AGGCAGAGGCTGCCCGGGGAGGG + Intronic
900579715 1:3403059-3403081 ACTCAGAGGAGGGCACGGGAAGG - Intronic
901551303 1:9997697-9997719 ACTCGGGGTCCGGCCGGGGAGGG + Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902413685 1:16226761-16226783 CCTCTGAGGCACGCCGAGGAAGG + Intergenic
902916956 1:19644955-19644977 ACACGGAGGCAGGCGGGGAACGG - Intronic
903652337 1:24929801-24929823 CCGCAGGGGAAGGCCGGGGAGGG + Exonic
903953985 1:27012521-27012543 ACTCAGGTGCCGTCCGGGGAAGG + Exonic
904380499 1:30107384-30107406 ACTGGGAGCCAGGTCGGGGAGGG - Intergenic
906130184 1:43451235-43451257 ACCCAGAGGCTGGCCAGTGAGGG - Exonic
907048992 1:51317093-51317115 AAGCAGAGGCAAGGCGGGGAAGG + Intronic
907165697 1:52408876-52408898 AGACAGAGGCAGGCTGGGTAAGG - Intronic
907489144 1:54797941-54797963 AGTCAGAGTCAGGCCAGGAAAGG - Intronic
908823827 1:68114901-68114923 CCTCAGTGGTAGGCCTGGGAGGG + Intronic
908951689 1:69568723-69568745 CCCCAGAGGCCGGCCGGGGGCGG + Intronic
910310627 1:85820136-85820158 ACTCAAGGGCAGGCCAGGCATGG - Intronic
911716429 1:101138814-101138836 CCTGAGAGGCAGGCAGGGCAAGG - Intergenic
912547422 1:110460942-110460964 ATCCAGAGGGAGGCCGGGGTGGG + Intergenic
913174003 1:116257272-116257294 ACTCAGAGGGAGGGAGGGGCAGG - Intergenic
914456410 1:147841140-147841162 ACCCAGAGGGAGGCGGGGGAAGG - Intergenic
914911453 1:151790608-151790630 GCTCAGGGGCAGCCCGCGGAAGG - Intronic
915283210 1:154836776-154836798 ACTCAGAGGGAGCCCAGGGGCGG - Intronic
915290237 1:154878566-154878588 TCTCAGAGCCAGGGCGGGGCGGG - Intergenic
915898890 1:159832435-159832457 GCTCAGAGCCATGCCTGGGAAGG + Intronic
916024277 1:160820484-160820506 AATCAGAGGCAGGACTGGGCAGG + Intronic
916419043 1:164619277-164619299 ACTCAGAGCCAGGCAGAGGGTGG + Intronic
917108712 1:171522477-171522499 ACTGAAAACCAGGCCGGGGACGG + Intronic
918115477 1:181492744-181492766 ACTCAGAGTCAGGTTGGGGAAGG - Intronic
918117647 1:181510658-181510680 ACTCACAGGCAGGAAGGGAATGG - Intronic
918861422 1:189831041-189831063 ACCTAGAGGCAGGCCGGGCGTGG - Intergenic
919543746 1:198884996-198885018 ACTCTGAGACTGGCCGGGCATGG - Intergenic
920138985 1:203793831-203793853 ACTGACAGGCCGGCCGGGCAGGG - Intergenic
920215992 1:204361864-204361886 TCCCAGAGGGAGGCCGGGGAGGG + Intronic
921217160 1:212947726-212947748 ACTCAGTGGTGGGCCGGGAAGGG - Intergenic
921629623 1:217417893-217417915 TCACAGAGGCAGGCAGGAGAAGG - Intergenic
922336628 1:224623582-224623604 GCTCAGAGGCAGTCAGGGGTGGG - Intronic
922745592 1:228041648-228041670 GCTCTGAGGCAGGCCTGGGATGG - Intronic
924819410 1:247474202-247474224 AGTCAGTGGCTGGCCGGGCACGG - Intergenic
1063086062 10:2818532-2818554 ACTGAGAGGGAGGGAGGGGATGG + Intergenic
1063122457 10:3114594-3114616 GCTCAGAGGCATGCCGAGGAGGG + Intronic
1063626934 10:7699002-7699024 TCAAAGAGGCAGGCCAGGGAAGG + Intergenic
1064283992 10:13976298-13976320 ACTCAGTGGCTGACCTGGGAGGG + Intronic
1065562154 10:26974628-26974650 ATGCAGAGGTAGGCCGGGCACGG - Intergenic
1067089617 10:43259906-43259928 ACGGAGGGGCAGGGCGGGGACGG + Intronic
1067832868 10:49620482-49620504 ACTCAGACACCTGCCGGGGAGGG - Exonic
1068391290 10:56400531-56400553 ACTCAGTGTCAGGCCGGGCGTGG + Intergenic
1069114890 10:64492632-64492654 GGTCAGAGGCAGGCAGAGGAAGG - Intergenic
1069730608 10:70609453-70609475 AACCTGAGGCAGGCCGGGCACGG - Intergenic
1070124233 10:73607538-73607560 ACTAAGAAGTAGGCCGGGTACGG + Intronic
1070409034 10:76122367-76122389 CCTCACAGACAGGCAGGGGAAGG - Intronic
1070630336 10:78080186-78080208 ATTCAGATGCAGGCCGAGCACGG - Intergenic
1070765903 10:79056275-79056297 ACTGAGACCCAGGCAGGGGAAGG - Intergenic
1070993490 10:80754001-80754023 GCTCAGAGGCATGTCGGTGAAGG + Intergenic
1071214396 10:83382968-83382990 ATTCAGAAGCAGGCTGGGCACGG + Intergenic
1071545625 10:86526773-86526795 AGACAGAGGCAGGCCCGGCAAGG - Intergenic
1072657068 10:97337222-97337244 CCTCAGAGGGAGGCCAGGCAGGG - Intergenic
1072734394 10:97869260-97869282 ACCCAGAGGCAGCCCGGTGAAGG + Exonic
1072758716 10:98038494-98038516 ACTCAAAGGCAAGGCGGGGCGGG + Intergenic
1072887317 10:99290015-99290037 ACTCAGAGGTAAGCAGGGGTTGG + Intergenic
1075095584 10:119468734-119468756 AGTCAGAGGCAGGCAGAGAACGG + Intergenic
1075624654 10:123953448-123953470 ACTAAGAAGAAGGCCGGGCACGG + Intergenic
1075625098 10:123958282-123958304 ACTCAGGGGCAGGAGTGGGAAGG + Intergenic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1076136010 10:128046134-128046156 AGTCAGTGCCAGGCCTGGGAGGG + Intronic
1076511421 10:131016724-131016746 AATCAGAGCCAGGCCGGGTGCGG + Intergenic
1076643516 10:131935330-131935352 ACTCAGAGACAGGAAGGGCAAGG - Intronic
1077477884 11:2799211-2799233 TCTCAGAGGCAGGCAGGGGCCGG + Intronic
1078086104 11:8233756-8233778 TCCCAGAGCCAGGCTGGGGAAGG - Intronic
1080311982 11:30905347-30905369 ACTCAGTGACAGGCCTGGGAGGG - Intronic
1080463648 11:32477132-32477154 AAGCAGAGTCAGGCCGGGCATGG + Intergenic
1081700779 11:45151261-45151283 TCTCAGAGTGAGGCCTGGGAGGG + Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084519719 11:69655833-69655855 ACCCAGCTGCAGGCCGGGGGTGG - Intronic
1085024837 11:73230325-73230347 ACTGAGAGCCAAGCAGGGGAAGG - Intronic
1085037050 11:73307122-73307144 ACTCAGACGGAGGCAGGGGCGGG + Intergenic
1085080303 11:73628455-73628477 ACTAGGAGGCAGGCAGGAGATGG - Intergenic
1085094392 11:73747493-73747515 TCTTAGAGGCTGGCCGGGCATGG - Intronic
1086062804 11:82717830-82717852 ACTCAGTCACAGGCCGGGCATGG + Intergenic
1087675277 11:101154479-101154501 ACCCAGAGGAAGGACTGGGAGGG + Intergenic
1090415412 11:126536982-126537004 GCTCAGAGGCAGGCAGGAGGTGG + Intronic
1092226362 12:6750672-6750694 ACTGAGAGCAAGGCCGGGGAAGG + Intronic
1096077614 12:48815035-48815057 ACACAGAGCCGAGCCGGGGACGG + Intronic
1096085225 12:48861247-48861269 ACTCAGAGGGAGGACTGGGCTGG - Intronic
1097961142 12:65532952-65532974 ACCTAGAGGCAGGCTGGGGGAGG - Intergenic
1098081605 12:66791828-66791850 ACTCAGAAGCAGGGAGGGTAAGG - Intronic
1099983127 12:89629827-89629849 ACTTAGAAGCAGGGTGGGGAGGG + Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101876640 12:108600371-108600393 ACTCGGAAGCTGGCAGGGGAAGG + Intergenic
1102595916 12:113992556-113992578 AGACAGAGGCAGGCAGGGGCAGG - Intergenic
1103451412 12:121031898-121031920 ACTCATAGGGAGGCCGGGTGTGG + Intronic
1103617319 12:122162532-122162554 CATCAGAGCCAGGCCTGGGAGGG - Intergenic
1103973482 12:124687066-124687088 ACTCACTGGCAGGACAGGGAGGG - Intergenic
1104795044 12:131511467-131511489 ATTCAGAGACAGGACGGGGGTGG - Intergenic
1104908479 12:132228234-132228256 TGTCAGAGGGACGCCGGGGAGGG - Intronic
1104949001 12:132430379-132430401 ACAGAGAGGCAGGTCTGGGAAGG + Intergenic
1107021740 13:35759308-35759330 ACTCAGAGACAGGCAGAGGATGG - Intergenic
1108002836 13:45920715-45920737 AGTCTGAGGTAGGCCGGGCACGG + Intergenic
1108681097 13:52781064-52781086 ATGCAGATGCAGGCTGGGGAAGG + Intergenic
1112614084 13:100985590-100985612 ACTCAAAGGTAGGCAGAGGAGGG + Intergenic
1113523308 13:110955372-110955394 CCTCTGAGTCAGGCAGGGGATGG - Intergenic
1113701999 13:112395124-112395146 CCTCTGAGTCAGGCAGGGGATGG + Intronic
1113787604 13:113010706-113010728 GCTCAGAGGCAGGTCTGAGAGGG - Intronic
1113848142 13:113403898-113403920 ACTCAGAGGCAGACCCAGAAAGG - Intergenic
1114554387 14:23553307-23553329 AAGCAGAGGCTGGCCGGGCATGG + Intronic
1114659921 14:24337555-24337577 ACTCAGGGGTGGGCTGGGGACGG + Intronic
1115812643 14:37127037-37127059 TCTCAGAACCAGGCTGGGGATGG - Intronic
1116876451 14:50116622-50116644 ACTCAGCGGCGGGCAGGGGGCGG - Intergenic
1117787568 14:59302942-59302964 ACTTAGAGGCTGGCTGGGCACGG - Intronic
1118413346 14:65505600-65505622 ACTGAGATGTAGGCCGGGCACGG - Intronic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1118748421 14:68790227-68790249 ACCCAGAAGCAGCCCGGGGGCGG - Exonic
1118780856 14:69006575-69006597 AGTTAGAGGCAGCCCGGGGTTGG + Intergenic
1119702985 14:76767931-76767953 ACCCAGAGCCAGGCCTGGGCCGG - Intronic
1120652832 14:87155199-87155221 ACCCTAAGGCAGGCCGGGCACGG + Intergenic
1121006115 14:90491726-90491748 ACGCACAGGCAGGCGGGGGGAGG - Intergenic
1121734010 14:96205472-96205494 AATCAGAAGCAGGCGGGGGTGGG + Intronic
1122227419 14:100287695-100287717 AATAAGAGGCAGGCCAGGGTGGG - Intergenic
1122288738 14:100668138-100668160 ACTCAGCGGCTGGCTGGGGTCGG + Intergenic
1122544019 14:102512473-102512495 ACACTGAGGCTGGCTGGGGAGGG - Intergenic
1122584505 14:102795924-102795946 ACTCAAGGACAGGCCGGGCATGG + Intronic
1122599897 14:102915957-102915979 ACTCAGAGGGAAGCCCAGGAGGG - Intergenic
1122762124 14:104036924-104036946 ACTCAGAGGCAGGCAGAGTTTGG - Intronic
1122917932 14:104867348-104867370 ACACAGAGGCAGGGCGGGGATGG - Intronic
1124157812 15:27243374-27243396 ACTCAAATGTAGGCAGGGGATGG + Intronic
1124218365 15:27828189-27828211 ACTGGGAGGAAGGCCGGGAATGG - Intronic
1124641567 15:31399453-31399475 ACTCAGAGATAGGCTGGGCACGG - Intronic
1124942092 15:34227888-34227910 AATTAAAGGCAGGCCGGGCATGG + Intronic
1125366306 15:38920379-38920401 ACTCAGAGGGTGGCAGGGCAGGG + Intergenic
1125390818 15:39190981-39191003 ACTCACTGGCAGCCTGGGGAAGG - Intergenic
1125599559 15:40907725-40907747 GGTCAGAGGCAGGCCTGGGGCGG + Intergenic
1125765791 15:42135063-42135085 AATCAAAGACAGGCCGGGTATGG + Intergenic
1127272450 15:57413574-57413596 ACTGAGATGCTGGCCGGGCATGG - Intronic
1128132312 15:65237104-65237126 ACGCTGAGTCAGGCCTGGGAGGG + Intronic
1128326366 15:66726486-66726508 ACTGAGAGGGAAGCCGAGGAGGG + Intronic
1128359653 15:66953102-66953124 GCTCAGAAGCAGCCTGGGGATGG - Intergenic
1128960895 15:72003404-72003426 ACTCAAAAGCAGGCCGGGCGCGG + Intronic
1129064372 15:72888944-72888966 CCTCAGAAGCAGGCCGAGAAAGG + Intergenic
1129117771 15:73374837-73374859 ACTCAGAGCCAGGCCAGAGAGGG + Intergenic
1129512628 15:76136231-76136253 ACACAGCTGCAGGCCGGGCATGG - Intronic
1130661853 15:85837087-85837109 AATGAGATGCAGGCCGGGCACGG - Intergenic
1131040483 15:89260973-89260995 ACAAAGAAGCAGGCCGGGCATGG + Intronic
1131373569 15:91904636-91904658 TGGCAGAGGCAGGTCGGGGAAGG + Intronic
1132674896 16:1117467-1117489 ACTCTGAGCCAGGGCCGGGAGGG + Intergenic
1132711862 16:1272430-1272452 ACGGAGAGGCTGGCCCGGGAGGG - Intergenic
1132941798 16:2512204-2512226 ACTCAGAGGGCGGTCGGGGCTGG + Intronic
1134908429 16:18002221-18002243 ACTCAGAGGGAAAGCGGGGAGGG + Intergenic
1135389265 16:22075551-22075573 ACTCCGGGGGAAGCCGGGGAGGG - Exonic
1135420877 16:22304807-22304829 TCTGAGAGGCAGGCAGGCGAGGG - Intronic
1135421885 16:22310575-22310597 ACTAAGACACAGGCCGGGCATGG - Intronic
1136412976 16:30087640-30087662 ACTAAGAGTCAGGCAGGGGAGGG - Intronic
1137492194 16:48942587-48942609 ACTCAGAAGTAGGCCTGGCAAGG - Intergenic
1138562229 16:57808318-57808340 GCTGAGAGGCGGGCCGGGGGCGG - Intronic
1139392102 16:66611615-66611637 AGACAGAGGCTGGCCAGGGAGGG + Intronic
1139443028 16:66978422-66978444 ACTCACAGCCAGACCTGGGAAGG - Intergenic
1139558750 16:67728751-67728773 ACTCAGAGGAGGGCCAGGGAGGG - Intronic
1140920723 16:79535254-79535276 ACTCAGAGACTGGCTGTGGATGG + Intergenic
1141136381 16:81468343-81468365 ACTCAGAGAGAGGCCGGGGCTGG + Intronic
1141695039 16:85615077-85615099 ACACCGAGGGAGGCCAGGGAAGG - Intronic
1141906970 16:87033257-87033279 ACAAAAAGGCAGGCGGGGGATGG + Intergenic
1141909497 16:87048898-87048920 ACTGAGCGCCTGGCCGGGGACGG + Intergenic
1142201825 16:88764787-88764809 AGTCAAAGGCAGGCCGTGGCAGG - Intronic
1142201941 16:88765257-88765279 ACTCGGAGGCAGCCTGGAGAGGG + Intronic
1142604250 17:1072888-1072910 AATCAGAGTCAGGCCGGGCACGG + Intronic
1142799972 17:2338531-2338553 CCACAGAGGCAGGCAGGGGAAGG - Intronic
1142850135 17:2700823-2700845 ACCCTGTGGCAGGCAGGGGAGGG + Exonic
1143217161 17:5233659-5233681 ACTGAGAGGCAGGCGGGGCATGG - Intronic
1143258799 17:5583576-5583598 GCTCAGAGGAAGGCCTGGCAGGG + Intronic
1143325965 17:6098627-6098649 ACGCAGAGGCAGCCCGGATAAGG - Intronic
1143632897 17:8148896-8148918 AGGCAGAGGTAGGCCGGGCACGG + Intronic
1144175919 17:12707413-12707435 ACACAGAAGCAGGCTGGGCACGG + Intronic
1144736662 17:17559434-17559456 CCTCAGAGGCCTGTCGGGGAAGG + Intronic
1144837055 17:18162003-18162025 ATTCAGAGGCAGGAAGGGTAAGG - Intronic
1145122453 17:20273006-20273028 CCTCATACGCAGGCCAGGGAGGG - Intronic
1145972296 17:28963509-28963531 ACATAGAGGCAGGCAGGTGAGGG - Intronic
1146229300 17:31094651-31094673 ACCCGGAGGCCGGCGGGGGAGGG + Intergenic
1146567714 17:33927809-33927831 TCTCAGGGGTAGGCAGGGGAGGG - Intronic
1146808165 17:35881965-35881987 ATTCAGATGCCGGCCGGGTACGG - Intergenic
1147010459 17:37442574-37442596 AGTCAAAGGTAGGTCGGGGAGGG - Exonic
1147155942 17:38544544-38544566 AATCAGAGACAGGAAGGGGAGGG + Intronic
1147844261 17:43393844-43393866 ACACTGAGGCAGGCAGGAGAGGG - Intergenic
1147902707 17:43799736-43799758 ACAGAGAGCCAGGCCAGGGAGGG - Intergenic
1148053276 17:44779611-44779633 AGTCACAGGCTGGCCAGGGAAGG - Intronic
1148809935 17:50283902-50283924 ACTGAGAGATAGGCAGGGGAAGG - Intergenic
1148850095 17:50550442-50550464 TCTCTGAGGCAGGCGGGGGAGGG - Intronic
1148914314 17:50961531-50961553 ACTAAGGGGCAGGCAGGGTAAGG + Intergenic
1149230937 17:54533104-54533126 ACCTAGAGGCAGGCTGGGCATGG - Intergenic
1150214929 17:63462029-63462051 ACTGAGAGTCAGGCCGGGCGCGG - Intergenic
1150258989 17:63773457-63773479 GCCGAGAGGCAGGCCGGGCAGGG - Exonic
1151483568 17:74384590-74384612 ACTCAAAGGCGGGCGGGGTAGGG + Intergenic
1151491141 17:74432770-74432792 ACCGAGAGGCAGGCGGTGGAGGG - Intronic
1151979083 17:77498433-77498455 AGTCCGAGGCAGGCCGAGCAGGG + Intronic
1152261442 17:79269465-79269487 TCTCAGAGGCAGGAGTGGGAAGG - Intronic
1152521031 17:80857166-80857188 CCTCAGAGGCAGGGGAGGGAGGG - Intronic
1153910408 18:9701778-9701800 AGTCAGTGGCAGGCCGGGCGCGG - Intergenic
1154044966 18:10895769-10895791 ACTCAGAGCCAGGCACGGGCAGG + Intronic
1154135906 18:11777972-11777994 ACCCAGAGGCAGCCCAGTGAGGG - Intronic
1154293506 18:13130763-13130785 ACGCTGAGGCAGGGCAGGGAAGG + Intergenic
1154303570 18:13215347-13215369 ACACAGGGACAGGCCGGGCACGG + Intergenic
1154329960 18:13421530-13421552 ACTCCCAGGCAGGGCAGGGATGG - Intronic
1155791117 18:29971831-29971853 ACACAGAGGCAGGCTGGGTGCGG - Intergenic
1156088901 18:33441291-33441313 ACTAAGTGGCAGGCCGGGTGTGG + Intergenic
1156253875 18:35377093-35377115 ACTCAGGGGCAGGCAGCGGAGGG + Intronic
1156866486 18:41894419-41894441 ACACAGAGGTAGGCTGGGCACGG - Intergenic
1157462971 18:47918066-47918088 ACTGAGGGCCAGGCAGGGGAAGG + Intronic
1158544822 18:58387034-58387056 ACACAGAGGGAGGCAGGTGATGG - Intronic
1159325693 18:66913716-66913738 AATCAGAGGCAGGAAGGGCATGG + Intergenic
1160560119 18:79750926-79750948 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160560190 18:79751131-79751153 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160947511 19:1650653-1650675 CCTCAGAGGAAGCCCGGGGTTGG - Intronic
1161258135 19:3321044-3321066 ACTCAGCGGCTTGCAGGGGAGGG - Intergenic
1161327278 19:3669963-3669985 GGGCAGGGGCAGGCCGGGGAGGG + Intronic
1161709113 19:5837934-5837956 ACTCAGAGCCCGGACTGGGAGGG + Intronic
1161925106 19:7294046-7294068 GCCCAGAGGCAGCCCCGGGAAGG + Intergenic
1162399402 19:10435787-10435809 AGTCAGTGGCAAGCCAGGGAGGG + Intronic
1162479977 19:10922296-10922318 ACTCAGAGGCGCCGCGGGGAGGG + Exonic
1162821276 19:13225058-13225080 ACTCTGGGGCAGGGCGGGGGTGG - Intronic
1165992603 19:39825283-39825305 CCTCAGAGGCATGGTGGGGAAGG - Intergenic
1166104363 19:40590108-40590130 ACTCAAAAGCAGGCTAGGGATGG + Intronic
1166668696 19:44697240-44697262 GCTCTGAGGCAGGCCCGGCACGG + Intergenic
1166946098 19:46397417-46397439 ACTCAGAGGCAGGCTGGTGTAGG - Intergenic
1167035063 19:46990305-46990327 ACAGAGAGGCAGGCTGGGGCAGG - Intronic
1167788473 19:51655472-51655494 TCTCAGACGCGGGCCGGGGGAGG - Intergenic
1168469722 19:56630328-56630350 ACTCAGAGGCAGGACAAGGCGGG + Intergenic
1168688475 19:58362676-58362698 ACGCAGAGGCGGGCCGAGGACGG - Exonic
925035258 2:680166-680188 ACCCAGAGGCAGCCTTGGGAGGG + Intergenic
925147616 2:1591620-1591642 ACTCAGCTCCACGCCGGGGATGG + Intergenic
925157359 2:1658143-1658165 CCTCAGAGGCCGGGCGGGCAAGG - Intronic
926150162 2:10421371-10421393 ACTCAGGGGAATGCCAGGGAGGG - Intronic
926570401 2:14523571-14523593 AAAGAGAGGCAGGCCGGGCACGG + Intergenic
926975736 2:18515104-18515126 AGACAGAAGCAGGCCTGGGAAGG - Intergenic
927040505 2:19226057-19226079 CACCAGAGGCAGGCCTGGGATGG + Intergenic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
927864213 2:26578346-26578368 ACTCTGAGGCAAGCCGGGAGTGG - Intronic
927952441 2:27181442-27181464 AGTCAGTGTCAGGCCGGGCATGG - Intergenic
928399776 2:30969405-30969427 ACTCAGGGGCAAGTTGGGGAGGG + Intronic
932246099 2:70197897-70197919 AGGCAGAGGCAGGCCGGGTGCGG - Intronic
932449507 2:71800580-71800602 ACTCAGAGGGAGGCAGCTGATGG - Intergenic
933655923 2:84886935-84886957 ACACATATGCAGGGCGGGGAGGG - Intronic
933786731 2:85849085-85849107 ACTCAGAGGAAAGGCGGGCATGG + Intronic
935123029 2:100198651-100198673 ACTCAGGGCCTGGCCGGGCACGG + Intergenic
935199617 2:100845002-100845024 ACTTAGAGGCAGGCAGGGGGTGG + Intronic
935292248 2:101620546-101620568 ACTGAGAGGGTGGCTGGGGAAGG - Intergenic
935330576 2:101974658-101974680 ACTCAAAGGCAGGCAGGGAGTGG - Intergenic
935675982 2:105595326-105595348 ACAGAGAGGAAGGCCGAGGATGG - Intergenic
935740755 2:106145475-106145497 ACTCAGGAGCAAGGCGGGGAAGG + Intronic
936345760 2:111673723-111673745 ACCCAGACGCAGGCAGGGGCTGG + Intergenic
937312505 2:120910786-120910808 AGTCAGAGGCAAGTCCGGGAGGG - Intronic
937505485 2:122531920-122531942 TGTCAGATGCAGGCTGGGGAGGG - Intergenic
938032884 2:128010566-128010588 ACCAAGAGCCAGGCCGGGCACGG + Intronic
938059055 2:128238110-128238132 ACTCAAAGGCAGGCTGAGGAGGG - Intronic
938163795 2:129009174-129009196 AGGGAGAGGCAGGCCAGGGACGG + Intergenic
938288980 2:130139678-130139700 GCTCAGAAGCAGGCTGGGGGCGG + Exonic
938981070 2:136527700-136527722 ATACAGAGGCAGGCCCGGCATGG - Intergenic
941295837 2:163736838-163736860 ATTCACAGGGAGGCGGGGGAGGG - Intergenic
942450095 2:176103929-176103951 ACTCAGAGGGCGGCGGGGAAGGG + Intergenic
942466307 2:176210474-176210496 AATCAGAATCAGGCCGGGCACGG - Intergenic
942978493 2:182049040-182049062 TCTCTGAGGCAGGCCAGGCATGG + Intronic
944733470 2:202538161-202538183 ATTCAGAGGTTGGCCGGGCACGG + Intronic
944867973 2:203880909-203880931 TCTCAGAGGCAGGCCGTAGGAGG - Intergenic
945929595 2:215841790-215841812 ATTCAGGAGCAGGCCGGGCACGG + Intergenic
946355591 2:219182422-219182444 CCTCAGGGGCAGGCAGGGGCTGG - Exonic
946363966 2:219237054-219237076 ACTGAAAGGTAGGCCGGGCATGG - Exonic
946412361 2:219521704-219521726 ACTCAGAGGCAGCCTGAGGCCGG - Intronic
946921174 2:224584284-224584306 ACTCGGAGGAAGGCCGGGTGGGG - Intronic
947740557 2:232482975-232482997 ACTCAGCGGCAGGCCAGGGCAGG + Intronic
947745035 2:232503084-232503106 ACTCTGCGGAAGGCCGGGGCGGG + Intergenic
948084081 2:235232020-235232042 ACTCAAAGAGATGCCGGGGAAGG + Intergenic
948366054 2:237455494-237455516 ACTCAGTGACAGGCTGGAGATGG + Intergenic
948761856 2:240197275-240197297 GAACAGAGGCAGGCCGGGGCAGG - Intergenic
948874742 2:240820482-240820504 TCTCAGGGGCACGCCGGGGGAGG - Intergenic
948884110 2:240874470-240874492 ATTCTGAGCCAGGCCGGGCAGGG + Intronic
948962396 2:241350121-241350143 ATGCAGATGCAGGGCGGGGATGG + Exonic
948993773 2:241568087-241568109 GCTCTGAGGCAGGCTGGGCATGG - Intronic
1169075114 20:2755605-2755627 ACTCCGGGGCGGGGCGGGGAGGG - Exonic
1169791426 20:9414330-9414352 ACACAGAGGCATGCAGGTGACGG - Intronic
1170406458 20:16043102-16043124 GCTCAAAGGCGGGCAGGGGATGG + Intronic
1170836415 20:19888585-19888607 ACACAGAGGAAGGCCAGTGAAGG - Intronic
1171418376 20:24999304-24999326 ACTCAGAGGCATTCCATGGAAGG + Intergenic
1172590048 20:36111493-36111515 ACCCCGAGGGAGGCCGGGCATGG + Intronic
1173233804 20:41225350-41225372 ACTCAGAGGCTGGCCACTGAAGG + Intronic
1174072473 20:47908778-47908800 TCTCAGAGCCAGACCGGGGGCGG - Intergenic
1174216348 20:48919604-48919626 ACTCAGAAGCAGCCCTGGGCAGG - Intergenic
1174786294 20:53436396-53436418 GCTCAGAGGCTGCCCAGGGAAGG + Intronic
1175248147 20:57593550-57593572 ACTCAGGGAAAGGCCCGGGAGGG + Intergenic
1175744447 20:61445445-61445467 CCTCTGAGGCAGGCGGGGCATGG + Intronic
1175824675 20:61930498-61930520 AGTGGGAGGCAGGGCGGGGAAGG + Intronic
1175898882 20:62352227-62352249 ACGGAGAGGTGGGCCGGGGAGGG - Exonic
1175965646 20:62658847-62658869 ACTCTGAGTCAGGCCGGGCGCGG + Intronic
1178201254 21:30408796-30408818 ACTCAGAGGCGGGTCAGGTATGG - Intronic
1178343517 21:31805863-31805885 ATGCAGAGGCAGGCTGGGGGTGG + Intergenic
1178701758 21:34839839-34839861 AATCAGAAGCAGGCAGGAGAAGG - Intronic
1178877076 21:36421764-36421786 AAACAGAGGCTGGCCGGGTACGG - Intergenic
1179356493 21:40665187-40665209 ACACAGAGGCAGGCTGGGCATGG + Intronic
1179653831 21:42832819-42832841 AGTCAGAGGAAGGCAGGGCAAGG - Intergenic
1179987119 21:44928068-44928090 ACGCAGAGGAAGGCAGAGGAGGG - Intronic
1180045160 21:45301796-45301818 ACTCAGGGGCAGGCTCGGCAGGG + Intergenic
1180087375 21:45514059-45514081 ACTCAGAGGCAGGCAGGCAGTGG + Exonic
1180142716 21:45902026-45902048 ACTCAAAGGCAGGCAGGAGGGGG + Intronic
1180171395 21:46060553-46060575 ACTGAGAGCCAGGGTGGGGAAGG - Intergenic
1180183167 21:46126975-46126997 GCTCCGAGGCAGGCCAGGGTTGG - Intronic
1180971650 22:19819153-19819175 ACTCAGAGGCAGGCCCTCCAGGG + Intronic
1181172655 22:21018387-21018409 ACCCAGAGGCAGGACCAGGATGG - Intronic
1181257346 22:21572142-21572164 ACTCTGAGGCAGGCCAGGCGTGG + Intronic
1181414665 22:22750715-22750737 AATGAGAGGCAGGCCGAGGTGGG - Intronic
1181526586 22:23492881-23492903 ACTCTGAAACAGGCCTGGGAAGG + Intergenic
1181851158 22:25750860-25750882 AGTCAGAGCCAGGAAGGGGAAGG + Intronic
1182222900 22:28772869-28772891 GCTCAGAGGGAGGCCGCTGAAGG - Exonic
1182288267 22:29260478-29260500 CCTCAGAGGCAGGCCTGGACTGG - Exonic
1182440670 22:30362157-30362179 GCTCAGAGGCACCCAGGGGAGGG - Intronic
1183361445 22:37385141-37385163 CCTGAGAGGTAGCCCGGGGAGGG + Intronic
1183522048 22:38301080-38301102 ACTAAGGGGCAGGCCAGAGAAGG + Intronic
1183538076 22:38414643-38414665 AAACAAAGGCAGGCCGGGCATGG - Intergenic
1184299037 22:43544080-43544102 GCTCAGGGGGAGGCTGGGGAGGG - Intronic
1184372027 22:44088760-44088782 AGTCTGAGGGAGGCCGGGCACGG - Intronic
1184601192 22:45544375-45544397 AGTTAGAGGCAGGCCGGGCGCGG - Intronic
1184804166 22:46781699-46781721 ACTCCGGGGCAGGCCAGGGAGGG - Intronic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
949272772 3:2239013-2239035 AAACAGAGCCAGGCCGGGCACGG - Exonic
949604540 3:5638783-5638805 TCTCAGAGGCAGGCAGAGAAAGG + Intergenic
950267273 3:11583694-11583716 TCCCAGAGGCAGGCCTGGAATGG - Intronic
950430759 3:12949665-12949687 ACCCAGAGGAAGGAAGGGGATGG + Intronic
950467157 3:13162308-13162330 CCAGAGAGGCAGGCCAGGGAGGG + Intergenic
952240453 3:31526978-31527000 AAGCAGAGGAAGGCCGGGGGCGG - Intergenic
952953014 3:38539303-38539325 AGTCAGAGGCAGAGCTGGGAAGG - Intronic
953491893 3:43359828-43359850 TCTCAGAGGAGGGCCGGGCATGG + Intronic
954764315 3:52900279-52900301 AATCAGAGGCCTGCCAGGGAGGG - Intergenic
955191883 3:56769353-56769375 CCTCTCAGGCAGGCCAGGGAGGG + Intronic
955687685 3:61562576-61562598 AGGCAGGGGCTGGCCGGGGAGGG + Intronic
955924255 3:63990248-63990270 GCTCAGTGGCAGGCAGGGGAGGG - Exonic
956856090 3:73276267-73276289 ACTCAGAAGTAGGCTGGGAAGGG - Intergenic
958566282 3:95815542-95815564 ACTGAGAGGCAGGAGAGGGAGGG + Intergenic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
961175419 3:124831242-124831264 TCCCAGAGGCAGGCCAGGCATGG + Intronic
961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG + Intronic
961756218 3:129128673-129128695 ACACAGCGGGAGGCCTGGGATGG - Intronic
962665442 3:137649553-137649575 GCTCAGAGGTAGGTCAGGGATGG + Intergenic
965786246 3:172338353-172338375 TATCAGAGGCAGGAAGGGGAAGG + Intronic
967415226 3:189209540-189209562 ACTGGGAGGCAGGCAGGAGAGGG + Intronic
967570947 3:191027708-191027730 CCTCTGAGGCAGGACAGGGAGGG + Intergenic
968821980 4:2861134-2861156 ACTCTGAGGCAGGAAGGGGCTGG + Intronic
969319806 4:6404850-6404872 GCTAAGAGGCAGGCAAGGGAGGG + Intronic
969404906 4:6984665-6984687 TCTCAGAGAAAGGCCTGGGAGGG - Intronic
969859783 4:10026751-10026773 ACCCAGACACAGGCCGGGCATGG + Intronic
973534852 4:51870954-51870976 ACTCAGATCCAGGCAAGGGAAGG - Intronic
975181740 4:71353827-71353849 TCTCAGAGGCAGGCTGGTGAGGG - Intronic
975585407 4:75943144-75943166 ACTGTGAAGCAGGCCGGGCATGG + Intronic
976175158 4:82344262-82344284 AATCGGAGGCCGGCCGGGCACGG - Intergenic
980661167 4:135860408-135860430 ACTCACAGGCAGACAGGTGAGGG - Intergenic
981396373 4:144254384-144254406 GCTGATAGGCAGGCCGGGCACGG - Intergenic
981938190 4:150256070-150256092 AGACAGCGGCAGGCCTGGGATGG + Exonic
982101604 4:151973731-151973753 TCTCAGAGGTAGGCAGGGCAGGG + Intergenic
982894647 4:160903445-160903467 AATCATAGTCAGGCCAGGGATGG + Intergenic
983045349 4:162980256-162980278 CCTCAGAGGTAGGCAGGGGTAGG + Intergenic
983166422 4:164482351-164482373 AGTCAGAGGGAGGGTGGGGAGGG + Intergenic
985550062 5:528393-528415 ACTGACGGGCCGGCCGGGGACGG - Intergenic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
986969605 5:13316499-13316521 TCTCAGATGTAGGCCAGGGATGG + Intergenic
987998424 5:25316093-25316115 ACTCTGAGGCAGGCCGCGCGCGG + Intergenic
988491365 5:31708203-31708225 GCTCAGAGGCGGGCAGGGAAGGG - Intronic
991702632 5:69330624-69330646 ACTCAGAGGGAGACCTGGAATGG - Intronic
991943367 5:71876431-71876453 AATCACATGCAGGCCGGGCACGG - Intergenic
992765259 5:79992308-79992330 ACTCAGAGGCATGACTGCGAGGG - Intronic
994788719 5:104197147-104197169 ACACAGGGGCAGGTTGGGGATGG + Intergenic
996379554 5:122849356-122849378 GCTCAGAGCTAGGCCGGGAAAGG + Intronic
996520493 5:124420692-124420714 CCTCAGTGGCAGGCAGGGCAGGG + Intergenic
996770460 5:127080292-127080314 CCTCAGAGACAGGCTGGGGCAGG + Intergenic
997802713 5:136882594-136882616 ACTCAGAGGCAGGTAAGGAAAGG - Intergenic
998353174 5:141514120-141514142 ACTCAGAGCCAGGCTGCGGAGGG + Intergenic
999136049 5:149319920-149319942 AGTCAGAGGCAAGCTGTGGATGG + Intronic
999144213 5:149381835-149381857 ACTCAGTGCCAGGCCTGAGAGGG + Intronic
999257968 5:150220342-150220364 AATCAGGGGCAGGTGGGGGAGGG + Intronic
999466943 5:151816288-151816310 ACTCAGCAGAAGGCCTGGGATGG + Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000505997 5:162118905-162118927 ACTCAGAGGAAGACAGAGGAAGG + Intronic
1000630789 5:163588076-163588098 CCTCAGAGGAGGGGCGGGGAAGG + Intergenic
1001254307 5:170171884-170171906 GCTCAGGGACAGGCAGGGGAGGG - Intergenic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1001534393 5:172488557-172488579 AATCAGAGGCACTCCTGGGAGGG + Intergenic
1001570231 5:172725937-172725959 ACTGAGAGCCAGGCCAGGCAGGG - Intergenic
1002374020 5:178775435-178775457 GCCCAGAGGCAGGCCTGGCATGG + Intergenic
1002917422 6:1540581-1540603 ACCCAGGGGCAGGGTGGGGAGGG - Intergenic
1003124976 6:3348852-3348874 ACCCAGAGCCAGGGCAGGGAGGG + Intronic
1003290467 6:4775669-4775691 GCTCCGCGGCAGGCCGGGGGTGG - Intronic
1003610346 6:7608264-7608286 ACTAAGAGACAGGCCGGGCGTGG + Intronic
1006083409 6:31580391-31580413 ATTCAGAGGCAGGGAGGGGGTGG + Intergenic
1006383313 6:33714114-33714136 AGCCAGAGGCAGGCCTGGGGTGG + Intergenic
1007032222 6:38639362-38639384 ACTCAGAGGCTGGCCAGGGCAGG + Intronic
1007746344 6:44045827-44045849 GGCCAGAGGCAGGCCTGGGAGGG - Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1013021758 6:106228277-106228299 AGTCAGTGGCAGGCCTGCGATGG - Intronic
1013824630 6:114196402-114196424 ACTCAGCGGAAGGACGGGTATGG - Intronic
1014188653 6:118466023-118466045 ACACAGAGGGAGAGCGGGGAGGG + Intronic
1014376657 6:120683829-120683851 ACTCAGGGGAAGGCTGGGGAGGG + Intergenic
1016470909 6:144373508-144373530 GCTCAGAGGCTGGCAGGGAATGG + Intronic
1017590589 6:155974585-155974607 ACCCAGGGGCAGGCTGGGGCAGG + Intergenic
1018945834 6:168346153-168346175 CCCCAGAGCCAGGCCGGAGAGGG + Intergenic
1021141749 7:17033968-17033990 AAAAAGAGGCAGGCCGGGCACGG - Intergenic
1021883621 7:25116986-25117008 ACTGAGAGGCTGGCCGAGGAAGG + Intergenic
1022652410 7:32289296-32289318 ACTCAGAGGCAGGCTGAGGCAGG + Intronic
1023076387 7:36486495-36486517 ACTCAAAGGCAGGCAGAGGAAGG - Intergenic
1023760480 7:43461198-43461220 AGTCAGAGGGTGGCCGGGGCTGG + Intronic
1023858537 7:44201412-44201434 AGTCAGAGGCGGGGCGGGGTGGG + Intronic
1024584788 7:50832697-50832719 ACTCAGAAGCAGACAGGGCATGG + Intergenic
1025097294 7:56106281-56106303 ACGCAGAGGGAGGCCGCGGGCGG - Intronic
1026557362 7:71420124-71420146 TCTCCGAGGCAGGCGCGGGAAGG - Intronic
1026735255 7:72945136-72945158 AGTCAGGGCAAGGCCGGGGAAGG + Intronic
1026785597 7:73300065-73300087 AGTCAGGGCAAGGCCGGGGAAGG + Intergenic
1026931172 7:74223796-74223818 AGCCAGAGGCAGGCTGGGGCTGG + Intronic
1026979684 7:74519093-74519115 ATGCAGAGGCAGGAAGGGGAGGG + Intronic
1027054903 7:75043179-75043201 ACTGAGAGGCAGGGCCGGGTCGG - Intronic
1027108470 7:75419871-75419893 AGTCAGGGCAAGGCCGGGGAAGG - Intronic
1029095543 7:98082424-98082446 ACTCCAATGCAGGCCGGGCATGG - Intergenic
1029245252 7:99194893-99194915 ACTCAAAGCCAGGCCAGGCACGG - Intronic
1032197191 7:129796285-129796307 ACGCAGAGGGAGGCTGAGGAGGG - Intergenic
1032457912 7:132087564-132087586 ACACAGATCCAGGCCAGGGATGG + Intergenic
1032576604 7:133061129-133061151 CCTAAGAGGAAGGCCGGGGTGGG + Intronic
1034142713 7:148837151-148837173 ATTCAGAGGCAGGACGGCCATGG - Intronic
1034389409 7:150772817-150772839 AGTCAGTGGCTGCCCGGGGATGG + Intergenic
1035623405 8:1052177-1052199 GGTCAGAGGCAGGCCCAGGAAGG - Intergenic
1035766220 8:2107701-2107723 ACTCACAGGCAGGGTGGGGAAGG + Intronic
1035770755 8:2144962-2144984 CCTCAGCGGCAGGCCAGTGAAGG + Exonic
1036086420 8:5617652-5617674 ACTCAGAGGCTGTCCCGGGAGGG + Intergenic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1037605711 8:20435585-20435607 ACGCATAGGTAGGCAGGGGAGGG + Intergenic
1038696055 8:29807338-29807360 TGTCACAGGCAGGGCGGGGAAGG - Intergenic
1040111522 8:43568989-43569011 AGCTTGAGGCAGGCCGGGGAAGG - Intergenic
1040892529 8:52332560-52332582 ACTAAAATGCAGGCCGGGCACGG + Intronic
1041368380 8:57132857-57132879 CCTCAGATGCAGGCCAGGCATGG - Intergenic
1042287677 8:67132144-67132166 GCTCAGAGTGTGGCCGGGGAGGG + Intronic
1042524876 8:69753718-69753740 ACTCAAAGGCTGGCCAGGCATGG + Intronic
1043430031 8:80185648-80185670 ACTCAAAGGCAGCCAGGAGAAGG - Intronic
1044930683 8:97248854-97248876 GCTCTGAGGCAGGCCAGGGAGGG - Intergenic
1045246246 8:100443982-100444004 ACTAAGAGGCAGGACAGGGATGG + Intergenic
1046865999 8:119151061-119151083 AAGCAGAGGCAGGCCAGGCATGG - Intergenic
1047428810 8:124772574-124772596 AGTCAGAGGCAGGCAGAGAAGGG - Intergenic
1048933846 8:139339114-139339136 AGTCAGAGGGATGCCGGGTAGGG + Intergenic
1049228552 8:141470110-141470132 AGGCAGAGGCAGGGCCGGGAAGG - Intergenic
1049247336 8:141569798-141569820 ACTCACAGGCTGGCCTGTGATGG - Intergenic
1049252449 8:141596574-141596596 ACTCAGGAGGAGGCTGGGGAGGG + Intergenic
1049255413 8:141611174-141611196 ACTCGGAGTGAGGCCGGTGATGG - Intergenic
1049331887 8:142059011-142059033 ACTGAGAGGCAAGGCTGGGACGG - Intergenic
1049386532 8:142345581-142345603 ACTCAGGGGAAGGCCTGGCAGGG + Intronic
1049715254 8:144086740-144086762 ACCCAGGGGCAGGCGGGGCACGG + Intergenic
1049850374 8:144827318-144827340 AGTCAGAGGCGGGCAGGGGGCGG - Intergenic
1050746844 9:8885785-8885807 AGACAGAGGCAGGCCGGGCACGG - Intronic
1051070428 9:13159611-13159633 ATTCAGTGACAGGCAGGGGATGG + Intronic
1052760699 9:32588120-32588142 AGTCAGAGGCAGGCTGTGGCTGG - Intergenic
1055443352 9:76358213-76358235 AATCAGAGACAGGCCGGGTGCGG + Intronic
1056198186 9:84249176-84249198 ACTCAGAAGCAGGCCAGGCGTGG + Intergenic
1056526398 9:87446867-87446889 ACTGAGGGGCAGGGTGGGGATGG - Intergenic
1056593548 9:87985353-87985375 ACTCAGAGGCTGACATGGGATGG - Intergenic
1056723327 9:89089911-89089933 ACCCAGAGGCCTGCCGGGCAGGG + Intronic
1057339706 9:94188973-94188995 ACTCAGAGCCAGGCCGGGCGTGG + Intergenic
1057718771 9:97516217-97516239 ACTCTGAGCCAGGCAGGGGCTGG + Intronic
1059346642 9:113633451-113633473 AATCAGAAGCTGGCCGGGCACGG + Intergenic
1059380844 9:113922440-113922462 AGACAGGGGCAGGCCGGAGAGGG + Intronic
1060176430 9:121500205-121500227 AGACAGCGGCAGGCCGGGGCTGG + Intergenic
1060442689 9:123656233-123656255 AGTGAGAGGCAGGGCGGGGAGGG + Intronic
1061165096 9:128917646-128917668 ACTTAGAGGCTGGTCGGGAATGG + Exonic
1061260394 9:129477379-129477401 TCTCAGAGGCAGGCTCAGGAAGG - Intergenic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1061801737 9:133116566-133116588 ACACAGGGCCAGGCCCGGGAGGG + Intronic
1061886733 9:133594864-133594886 GCCCAGAGGCAGGCAGGGCAAGG + Intergenic
1062123645 9:134847948-134847970 ACCCAGACGCAGGCTGGGGGCGG + Intergenic
1062218206 9:135400362-135400384 AAACTGAGGCAGGCTGGGGATGG - Intergenic
1062485148 9:136770573-136770595 ACCCAGAGGCAGGCGGGGTGCGG - Intergenic
1062656732 9:137607455-137607477 ACGCGGAGGGAGGCCTGGGAGGG + Intronic
1185810149 X:3100883-3100905 ACTGAGAGTCAGGCCGGGCGCGG - Intronic
1186361965 X:8851788-8851810 AACCAGAGGGAGGCCGGGCATGG + Intergenic
1186720626 X:12300083-12300105 GCTCAGAGGAGGGTCGGGGAGGG + Intronic
1186799302 X:13077305-13077327 GCTCTGAGGAAGGCCGGGCATGG - Intergenic
1186922175 X:14294045-14294067 GCTCAGAGTCGGGCCGGGCATGG - Intergenic
1187280164 X:17852479-17852501 TCTCAGAGGCTGGCAGGGGAGGG + Intronic
1187285329 X:17898756-17898778 ACGCAGAGGCAGGAAGGGCAGGG - Intergenic
1188679521 X:32984543-32984565 ACACAGAGGTGGGCCGGGCACGG - Intronic
1188984274 X:36755421-36755443 AGCCTGAGGCAGGCAGGGGAGGG - Intergenic
1189366357 X:40391879-40391901 ACTCCAAGGGAGGCCGGGAAAGG + Intergenic
1189993047 X:46612635-46612657 ACTGAGATGCAGGCCGGGCATGG + Intronic
1191844486 X:65536416-65536438 AACCATAGGCAGGCCGGGCACGG - Intergenic
1193716915 X:84944360-84944382 ACTAAGAGTTAGGCCGGGCATGG - Intergenic
1196756298 X:119160345-119160367 ACTCAAAGGCAGGCAGGGGGTGG - Intergenic
1197444204 X:126528893-126528915 ACTTAGATTCAGGCCGGGCACGG + Intergenic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic