ID: 1160560331

View in Genome Browser
Species Human (GRCh38)
Location 18:79751998-79752020
Sequence CTCAGCTACAACCTTAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 86}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160560331_1160560338 9 Left 1160560331 18:79751998-79752020 CCACCTCTAAGGTTGTAGCTGAG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1160560338 18:79752030-79752052 CGCAGTGGGACGTCCCAGCACGG 0: 1
1: 0
2: 0
3: 4
4: 67
1160560331_1160560340 19 Left 1160560331 18:79751998-79752020 CCACCTCTAAGGTTGTAGCTGAG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1160560340 18:79752040-79752062 CGTCCCAGCACGGCACCAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 125
1160560331_1160560339 16 Left 1160560331 18:79751998-79752020 CCACCTCTAAGGTTGTAGCTGAG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1160560339 18:79752037-79752059 GGACGTCCCAGCACGGCACCAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1160560331_1160560336 -5 Left 1160560331 18:79751998-79752020 CCACCTCTAAGGTTGTAGCTGAG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1160560336 18:79752016-79752038 CTGAGGTTCCTTGGCGCAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 83
1160560331_1160560341 20 Left 1160560331 18:79751998-79752020 CCACCTCTAAGGTTGTAGCTGAG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1160560341 18:79752041-79752063 GTCCCAGCACGGCACCAGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 164
1160560331_1160560344 23 Left 1160560331 18:79751998-79752020 CCACCTCTAAGGTTGTAGCTGAG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1160560344 18:79752044-79752066 CCAGCACGGCACCAGGAGGGAGG 0: 1
1: 0
2: 4
3: 28
4: 236
1160560331_1160560345 24 Left 1160560331 18:79751998-79752020 CCACCTCTAAGGTTGTAGCTGAG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1160560345 18:79752045-79752067 CAGCACGGCACCAGGAGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 260
1160560331_1160560335 -6 Left 1160560331 18:79751998-79752020 CCACCTCTAAGGTTGTAGCTGAG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1160560335 18:79752015-79752037 GCTGAGGTTCCTTGGCGCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160560331 Original CRISPR CTCAGCTACAACCTTAGAGG TGG (reversed) Intronic
902555121 1:17242348-17242370 CTCAGCTACCACCTGAAATGTGG + Intronic
903922558 1:26810825-26810847 CAAAGTTAAAACCTTAGAGGAGG - Intergenic
905266425 1:36757163-36757185 CTCATCCACAACATTGGAGGTGG - Intergenic
907940259 1:59080712-59080734 CTCATCTGCAAATTTAGAGGGGG - Intergenic
909488184 1:76197518-76197540 CTGAGCTGAAAACTTAGAGGAGG + Intronic
917055178 1:170973180-170973202 CTCAGCTAAATACTTAAAGGGGG - Intronic
917429241 1:174948404-174948426 CCCAGCTACAGGCTAAGAGGTGG + Intronic
919444224 1:197681557-197681579 CTCATCTACAACCTAAAAGTAGG + Intronic
1065436239 10:25706399-25706421 CTCACATAAAACCTTAGAGAGGG - Intergenic
1068589511 10:58839182-58839204 CTCAGCAATAAAATTAGAGGTGG + Intergenic
1069756065 10:70775080-70775102 CTCAGCTCCCACCCTGGAGGGGG - Intronic
1074171965 10:110949537-110949559 CTCTTCCAAAACCTTAGAGGAGG + Intronic
1075420770 10:122298774-122298796 CTCAGCGAAAACCTATGAGGTGG - Intronic
1079779488 11:24582614-24582636 CTCATCTAAAACCTTATAAGTGG + Intronic
1080127144 11:28749003-28749025 CTCAGCCACGACCTCAGAAGGGG - Intergenic
1080855265 11:36106526-36106548 CTCAAATAAAACCTCAGAGGTGG + Intronic
1087315640 11:96599485-96599507 CTCAGCTTGAACCTTGGAGGCGG - Intergenic
1094605819 12:31948248-31948270 CTCAGCTTTCACCTCAGAGGAGG + Intergenic
1096181655 12:49554516-49554538 CTCAGCTACAACCTGGGTGCTGG + Exonic
1110190530 13:72724977-72724999 CCCAGCTTCAACCTGGGAGGCGG + Intronic
1112268471 13:97947401-97947423 CTCAGCTACACCCTTTCAGTGGG - Intergenic
1116885164 14:50213582-50213604 CTCAGCTTGAACCCTGGAGGTGG + Intronic
1118710740 14:68517380-68517402 CACTGCTACAAACTTACAGGGGG - Intronic
1122023016 14:98854762-98854784 CTCAGCTATATGCTGAGAGGAGG + Intergenic
1122042144 14:98996374-98996396 CCCAACAACAACTTTAGAGGTGG + Intergenic
1125390322 15:39185352-39185374 CTCATCTACATCCATAGAGATGG + Intergenic
1126643856 15:50855350-50855372 CTCAGATAAAACCATAGAGGAGG - Intergenic
1128241981 15:66107500-66107522 CTCAGCTTCTAACTCAGAGGTGG + Intronic
1128998791 15:72316429-72316451 CCCAGCTTCAAACTTAGGGGAGG - Intronic
1133474488 16:6107079-6107101 CTCAGCAGCAACATAAGAGGAGG - Intronic
1134672243 16:16064431-16064453 CTCAGTTACCACCTGAGGGGTGG + Intronic
1140801933 16:78496323-78496345 CTCATCTATAACTTTAGAAGAGG - Intronic
1145284121 17:21491130-21491152 CTCAGCTACAACCCAGGAGTTGG + Intergenic
1145393328 17:22474390-22474412 CTCAGCTACAACCCAGGAGTTGG - Intergenic
1157438297 18:47689806-47689828 CTCAGAGACAGCCTTAGATGTGG + Intergenic
1159248227 18:65837858-65837880 CTGATCTACAACCTTGGATGAGG - Intronic
1159810551 18:73013466-73013488 CCCGGCTACATCCTTATAGGAGG + Intergenic
1160560331 18:79751998-79752020 CTCAGCTACAACCTTAGAGGTGG - Intronic
1164545341 19:29156839-29156861 CTCAGCTTCAAACTTTGAGATGG + Intergenic
932595021 2:73088271-73088293 CTCTGCCACAGCCTCAGAGGAGG + Exonic
939394057 2:141605744-141605766 CTCAGCCACAAAGTTAGAAGTGG + Intronic
945423485 2:209668766-209668788 CTCAGCCACAACCCAAGAGAAGG - Intronic
948088350 2:235268888-235268910 CTCAGATACTACTTTAAAGGTGG + Intergenic
949047511 2:241878648-241878670 CTCAGGTGCAACCTCAGATGAGG - Intergenic
1170981114 20:21213771-21213793 ATCAGAGCCAACCTTAGAGGTGG - Intronic
1172195345 20:33087952-33087974 GTCAGCCACAACCTCAGAAGCGG + Intronic
1179045552 21:37841993-37842015 GTCAGGTACAACCTTTGTGGGGG - Intronic
1184662904 22:45973639-45973661 TTCAGCTCCAGCCTTGGAGGAGG - Intronic
952223615 3:31351016-31351038 TTCAGTTACAGGCTTAGAGGAGG - Intergenic
954706767 3:52485105-52485127 CTCAGTAACAACCACAGAGGAGG - Intronic
955698311 3:61658348-61658370 CTCAGGTACAAGGTTAGAGGAGG + Intronic
956174879 3:66463467-66463489 CCCAGCCATACCCTTAGAGGCGG + Intronic
960063681 3:113348926-113348948 TTTAGCTACAACCTGAGAGTTGG + Intronic
961194900 3:124993447-124993469 CTCAGCTGCCTCCTTAGAGAAGG - Intronic
961715407 3:128854043-128854065 CACAGCAGCAACCTTGGAGGAGG + Intergenic
964333410 3:155628676-155628698 CTCAGCTATGAACTTAGTGGTGG + Intronic
972612108 4:40665579-40665601 AACAGCTTGAACCTTAGAGGCGG - Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
975719783 4:77238375-77238397 CTCAGCTATAACCTTGGCTGAGG + Intronic
978645200 4:110922132-110922154 CTCAGCAAAAACCTTAGAGTTGG + Intergenic
982609661 4:157557837-157557859 TCCAGATACAACCTTAGATGAGG + Intergenic
988056105 5:26099157-26099179 CTCAGCTATAACATCAAAGGAGG + Intergenic
991478926 5:67055686-67055708 CCCAGGTAAAACCTTAGAGTTGG + Intronic
995042073 5:107600354-107600376 GTCAGTTACAACCTAAGAAGAGG + Intronic
997446342 5:133943097-133943119 CACAGCTACAGCCTCAGATGTGG + Intergenic
1000116731 5:158160765-158160787 CACAGCAACCACATTAGAGGCGG + Intergenic
1000293293 5:159891063-159891085 CATAGCTACCATCTTAGAGGGGG - Intergenic
1023900352 7:44472153-44472175 CTCAGCAACAAATTTTGAGGAGG + Intronic
1024355836 7:48412562-48412584 CTCAGACACCACCTTAGAAGAGG + Exonic
1025191428 7:56898654-56898676 CACAGCCACAGCCTGAGAGGGGG - Intergenic
1025680520 7:63678280-63678302 CACAGCCACAGCCTGAGAGGGGG + Intergenic
1025951038 7:66145697-66145719 ATCAGCCAAAACCCTAGAGGAGG - Intronic
1026334081 7:69378880-69378902 CCCAGCTCAAACCTTGGAGGTGG - Intergenic
1028368592 7:90064244-90064266 CTCAACTACAACCATAGAGGCGG - Intergenic
1031462566 7:122069712-122069734 CTAAGCTACAACCTAAAAAGAGG + Intergenic
1033742192 7:144284102-144284124 CCCTGCTTCATCCTTAGAGGTGG + Intergenic
1033751710 7:144365512-144365534 CCCTGCTTCATCCTTAGAGGTGG - Exonic
1034416779 7:150969453-150969475 CCCAGCTTCACCCTCAGAGGTGG - Intronic
1037547388 8:19938114-19938136 CTCAGCCATAAACTGAGAGGGGG + Intronic
1038539482 8:28380218-28380240 CTCAGCTACATCCCCAGAAGTGG + Intronic
1042885166 8:73541207-73541229 ATCAGCTAGAAATTTAGAGGAGG + Intronic
1043209311 8:77491273-77491295 GTCAGCTAAAACCTTAGAGTTGG + Intergenic
1044198284 8:89404007-89404029 CTCAGCTACAAACTTTGCTGAGG + Intergenic
1048211184 8:132455713-132455735 CTCACCGGCACCCTTAGAGGTGG + Intronic
1187611781 X:20951281-20951303 CTCAGCCAAAACCACAGAGGAGG + Intergenic
1187614291 X:20976346-20976368 CTCAGCAACAAACCTAGAGTGGG + Intergenic
1189208920 X:39266333-39266355 TTCAGCAACACCCTTTGAGGGGG - Intergenic
1189612205 X:42749218-42749240 TTCAGCCTCAATCTTAGAGGTGG + Intergenic
1190922641 X:54870671-54870693 CTCAGCCACAACCTCACAGTAGG - Intergenic
1194149360 X:90304265-90304287 CTGAGCTACAATGTTAGAAGTGG - Intergenic
1195143119 X:101984074-101984096 ATCAGCCTCAACCTTAGAGTAGG + Intergenic
1200495734 Y:3880995-3881017 CTGAGCTACAATGTTAGAAGTGG - Intergenic
1201908118 Y:19105828-19105850 CTCAGTTACAACTGAAGAGGTGG + Intergenic