ID: 1160562370

View in Genome Browser
Species Human (GRCh38)
Location 18:79766695-79766717
Sequence CCCTCTTGACCTAGAGACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160562370_1160562383 23 Left 1160562370 18:79766695-79766717 CCTTCGTCTCTAGGTCAAGAGGG No data
Right 1160562383 18:79766741-79766763 CTTCCGGCTTAGCTGGGGGTTGG No data
1160562370_1160562381 19 Left 1160562370 18:79766695-79766717 CCTTCGTCTCTAGGTCAAGAGGG No data
Right 1160562381 18:79766737-79766759 TCCTCTTCCGGCTTAGCTGGGGG No data
1160562370_1160562377 16 Left 1160562370 18:79766695-79766717 CCTTCGTCTCTAGGTCAAGAGGG No data
Right 1160562377 18:79766734-79766756 CCCTCCTCTTCCGGCTTAGCTGG No data
1160562370_1160562386 28 Left 1160562370 18:79766695-79766717 CCTTCGTCTCTAGGTCAAGAGGG No data
Right 1160562386 18:79766746-79766768 GGCTTAGCTGGGGGTTGGAAGGG No data
1160562370_1160562375 7 Left 1160562370 18:79766695-79766717 CCTTCGTCTCTAGGTCAAGAGGG No data
Right 1160562375 18:79766725-79766747 GGTGTGTTTCCCTCCTCTTCCGG No data
1160562370_1160562380 18 Left 1160562370 18:79766695-79766717 CCTTCGTCTCTAGGTCAAGAGGG No data
Right 1160562380 18:79766736-79766758 CTCCTCTTCCGGCTTAGCTGGGG No data
1160562370_1160562385 27 Left 1160562370 18:79766695-79766717 CCTTCGTCTCTAGGTCAAGAGGG No data
Right 1160562385 18:79766745-79766767 CGGCTTAGCTGGGGGTTGGAAGG No data
1160562370_1160562387 29 Left 1160562370 18:79766695-79766717 CCTTCGTCTCTAGGTCAAGAGGG No data
Right 1160562387 18:79766747-79766769 GCTTAGCTGGGGGTTGGAAGGGG No data
1160562370_1160562379 17 Left 1160562370 18:79766695-79766717 CCTTCGTCTCTAGGTCAAGAGGG No data
Right 1160562379 18:79766735-79766757 CCTCCTCTTCCGGCTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160562370 Original CRISPR CCCTCTTGACCTAGAGACGA AGG (reversed) Intergenic
No off target data available for this crispr