ID: 1160563926

View in Genome Browser
Species Human (GRCh38)
Location 18:79775314-79775336
Sequence CCTAAAGTGCTGTCTTTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160563926_1160563931 27 Left 1160563926 18:79775314-79775336 CCACGTAAAGACAGCACTTTAGG No data
Right 1160563931 18:79775364-79775386 GCATCATTGCTCTTGTGCTTTGG No data
1160563926_1160563932 28 Left 1160563926 18:79775314-79775336 CCACGTAAAGACAGCACTTTAGG No data
Right 1160563932 18:79775365-79775387 CATCATTGCTCTTGTGCTTTGGG No data
1160563926_1160563933 29 Left 1160563926 18:79775314-79775336 CCACGTAAAGACAGCACTTTAGG No data
Right 1160563933 18:79775366-79775388 ATCATTGCTCTTGTGCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160563926 Original CRISPR CCTAAAGTGCTGTCTTTACG TGG (reversed) Intergenic
No off target data available for this crispr