ID: 1160563929

View in Genome Browser
Species Human (GRCh38)
Location 18:79775342-79775364
Sequence CTGGCAATTCAGATCTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160563929_1160563936 27 Left 1160563929 18:79775342-79775364 CCTTGGCAGATCTGAATTGCCAG No data
Right 1160563936 18:79775392-79775414 AACATTATTAAGCAAAATGAGGG No data
1160563929_1160563933 1 Left 1160563929 18:79775342-79775364 CCTTGGCAGATCTGAATTGCCAG No data
Right 1160563933 18:79775366-79775388 ATCATTGCTCTTGTGCTTTGGGG No data
1160563929_1160563935 26 Left 1160563929 18:79775342-79775364 CCTTGGCAGATCTGAATTGCCAG No data
Right 1160563935 18:79775391-79775413 AAACATTATTAAGCAAAATGAGG No data
1160563929_1160563931 -1 Left 1160563929 18:79775342-79775364 CCTTGGCAGATCTGAATTGCCAG No data
Right 1160563931 18:79775364-79775386 GCATCATTGCTCTTGTGCTTTGG No data
1160563929_1160563932 0 Left 1160563929 18:79775342-79775364 CCTTGGCAGATCTGAATTGCCAG No data
Right 1160563932 18:79775365-79775387 CATCATTGCTCTTGTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160563929 Original CRISPR CTGGCAATTCAGATCTGCCA AGG (reversed) Intergenic
No off target data available for this crispr