ID: 1160563933 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:79775366-79775388 |
Sequence | ATCATTGCTCTTGTGCTTTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160563926_1160563933 | 29 | Left | 1160563926 | 18:79775314-79775336 | CCACGTAAAGACAGCACTTTAGG | No data | ||
Right | 1160563933 | 18:79775366-79775388 | ATCATTGCTCTTGTGCTTTGGGG | No data | ||||
1160563929_1160563933 | 1 | Left | 1160563929 | 18:79775342-79775364 | CCTTGGCAGATCTGAATTGCCAG | No data | ||
Right | 1160563933 | 18:79775366-79775388 | ATCATTGCTCTTGTGCTTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160563933 | Original CRISPR | ATCATTGCTCTTGTGCTTTG GGG | Intergenic | ||
No off target data available for this crispr |