ID: 1160563935

View in Genome Browser
Species Human (GRCh38)
Location 18:79775391-79775413
Sequence AAACATTATTAAGCAAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160563930_1160563935 7 Left 1160563930 18:79775361-79775383 CCAGCATCATTGCTCTTGTGCTT No data
Right 1160563935 18:79775391-79775413 AAACATTATTAAGCAAAATGAGG No data
1160563929_1160563935 26 Left 1160563929 18:79775342-79775364 CCTTGGCAGATCTGAATTGCCAG No data
Right 1160563935 18:79775391-79775413 AAACATTATTAAGCAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160563935 Original CRISPR AAACATTATTAAGCAAAATG AGG Intergenic
No off target data available for this crispr