ID: 1160563936

View in Genome Browser
Species Human (GRCh38)
Location 18:79775392-79775414
Sequence AACATTATTAAGCAAAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160563930_1160563936 8 Left 1160563930 18:79775361-79775383 CCAGCATCATTGCTCTTGTGCTT No data
Right 1160563936 18:79775392-79775414 AACATTATTAAGCAAAATGAGGG No data
1160563929_1160563936 27 Left 1160563929 18:79775342-79775364 CCTTGGCAGATCTGAATTGCCAG No data
Right 1160563936 18:79775392-79775414 AACATTATTAAGCAAAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160563936 Original CRISPR AACATTATTAAGCAAAATGA GGG Intergenic
No off target data available for this crispr