ID: 1160563937

View in Genome Browser
Species Human (GRCh38)
Location 18:79775414-79775436
Sequence GTCACTTTACACCAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160563934_1160563937 2 Left 1160563934 18:79775389-79775411 CCAAACATTATTAAGCAAAATGA No data
Right 1160563937 18:79775414-79775436 GTCACTTTACACCAGCACTTTGG No data
1160563930_1160563937 30 Left 1160563930 18:79775361-79775383 CCAGCATCATTGCTCTTGTGCTT No data
Right 1160563937 18:79775414-79775436 GTCACTTTACACCAGCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160563937 Original CRISPR GTCACTTTACACCAGCACTT TGG Intergenic
No off target data available for this crispr