ID: 1160564520

View in Genome Browser
Species Human (GRCh38)
Location 18:79778792-79778814
Sequence GTCTGACTAAACCACACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160564520_1160564525 -10 Left 1160564520 18:79778792-79778814 CCTTCTGTGTGGTTTAGTCAGAC No data
Right 1160564525 18:79778805-79778827 TTAGTCAGACAGTGAGGGGTGGG No data
1160564520_1160564528 0 Left 1160564520 18:79778792-79778814 CCTTCTGTGTGGTTTAGTCAGAC No data
Right 1160564528 18:79778815-79778837 AGTGAGGGGTGGGGCGGCCCCGG No data
1160564520_1160564526 -9 Left 1160564520 18:79778792-79778814 CCTTCTGTGTGGTTTAGTCAGAC No data
Right 1160564526 18:79778806-79778828 TAGTCAGACAGTGAGGGGTGGGG No data
1160564520_1160564527 -6 Left 1160564520 18:79778792-79778814 CCTTCTGTGTGGTTTAGTCAGAC No data
Right 1160564527 18:79778809-79778831 TCAGACAGTGAGGGGTGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160564520 Original CRISPR GTCTGACTAAACCACACAGA AGG (reversed) Intergenic
No off target data available for this crispr