ID: 1160565186

View in Genome Browser
Species Human (GRCh38)
Location 18:79782701-79782723
Sequence CAGGCAGGTCAACCTGACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160565186_1160565191 28 Left 1160565186 18:79782701-79782723 CCGTGGTCAGGTTGACCTGCCTG No data
Right 1160565191 18:79782752-79782774 GCCCGGGTGTAGATGCCCTGAGG No data
1160565186_1160565190 12 Left 1160565186 18:79782701-79782723 CCGTGGTCAGGTTGACCTGCCTG No data
Right 1160565190 18:79782736-79782758 AAGCTGTGTGTGTTGTGCCCGGG No data
1160565186_1160565189 11 Left 1160565186 18:79782701-79782723 CCGTGGTCAGGTTGACCTGCCTG No data
Right 1160565189 18:79782735-79782757 TAAGCTGTGTGTGTTGTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160565186 Original CRISPR CAGGCAGGTCAACCTGACCA CGG (reversed) Intergenic
No off target data available for this crispr