ID: 1160565599

View in Genome Browser
Species Human (GRCh38)
Location 18:79784999-79785021
Sequence CTGTTTGTCCACAGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160565599_1160565609 17 Left 1160565599 18:79784999-79785021 CCTGTGTCCCTGTGGACAAACAG No data
Right 1160565609 18:79785039-79785061 TGAGCCGCCAGCGTGTGGTGAGG No data
1160565599_1160565608 12 Left 1160565599 18:79784999-79785021 CCTGTGTCCCTGTGGACAAACAG No data
Right 1160565608 18:79785034-79785056 GGGTTTGAGCCGCCAGCGTGTGG No data
1160565599_1160565606 -8 Left 1160565599 18:79784999-79785021 CCTGTGTCCCTGTGGACAAACAG No data
Right 1160565606 18:79785014-79785036 ACAAACAGTGTTTCCGGGGTGGG No data
1160565599_1160565605 -9 Left 1160565599 18:79784999-79785021 CCTGTGTCCCTGTGGACAAACAG No data
Right 1160565605 18:79785013-79785035 GACAAACAGTGTTTCCGGGGTGG No data
1160565599_1160565612 30 Left 1160565599 18:79784999-79785021 CCTGTGTCCCTGTGGACAAACAG No data
Right 1160565612 18:79785052-79785074 TGTGGTGAGGCAGAGCGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160565599 Original CRISPR CTGTTTGTCCACAGGGACAC AGG (reversed) Intergenic
No off target data available for this crispr