ID: 1160566405

View in Genome Browser
Species Human (GRCh38)
Location 18:79788832-79788854
Sequence GGGCCGACACAGCATCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160566405_1160566415 1 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566415 18:79788856-79788878 GCTCGGGGTCTCTGGGTTCTGGG No data
1160566405_1160566416 2 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566416 18:79788857-79788879 CTCGGGGTCTCTGGGTTCTGGGG No data
1160566405_1160566422 27 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566422 18:79788882-79788904 CGGAGCCCCGGTGGTTGGACAGG No data
1160566405_1160566419 18 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566419 18:79788873-79788895 TCTGGGGACCGGAGCCCCGGTGG No data
1160566405_1160566420 22 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566420 18:79788877-79788899 GGGACCGGAGCCCCGGTGGTTGG No data
1160566405_1160566417 7 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566417 18:79788862-79788884 GGTCTCTGGGTTCTGGGGACCGG No data
1160566405_1160566423 28 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566423 18:79788883-79788905 GGAGCCCCGGTGGTTGGACAGGG No data
1160566405_1160566414 0 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566414 18:79788855-79788877 GGCTCGGGGTCTCTGGGTTCTGG No data
1160566405_1160566411 -6 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566411 18:79788849-79788871 CGGCCCGGCTCGGGGTCTCTGGG No data
1160566405_1160566410 -7 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566410 18:79788848-79788870 TCGGCCCGGCTCGGGGTCTCTGG No data
1160566405_1160566418 15 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566418 18:79788870-79788892 GGTTCTGGGGACCGGAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160566405 Original CRISPR GGGCCGACACAGCATCCCAC AGG (reversed) Intergenic