ID: 1160566413

View in Genome Browser
Species Human (GRCh38)
Location 18:79788853-79788875
Sequence AGAACCCAGAGACCCCGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160566413_1160566422 6 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566422 18:79788882-79788904 CGGAGCCCCGGTGGTTGGACAGG No data
1160566413_1160566428 17 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566428 18:79788893-79788915 TGGTTGGACAGGGCAGGTGCAGG No data
1160566413_1160566423 7 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566423 18:79788883-79788905 GGAGCCCCGGTGGTTGGACAGGG No data
1160566413_1160566420 1 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566420 18:79788877-79788899 GGGACCGGAGCCCCGGTGGTTGG No data
1160566413_1160566419 -3 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566419 18:79788873-79788895 TCTGGGGACCGGAGCCCCGGTGG No data
1160566413_1160566418 -6 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566418 18:79788870-79788892 GGTTCTGGGGACCGGAGCCCCGG No data
1160566413_1160566431 25 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566431 18:79788901-79788923 CAGGGCAGGTGCAGGCCCCGGGG No data
1160566413_1160566429 23 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566429 18:79788899-79788921 GACAGGGCAGGTGCAGGCCCCGG No data
1160566413_1160566430 24 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566430 18:79788900-79788922 ACAGGGCAGGTGCAGGCCCCGGG No data
1160566413_1160566425 11 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566425 18:79788887-79788909 CCCCGGTGGTTGGACAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160566413 Original CRISPR AGAACCCAGAGACCCCGAGC CGG (reversed) Intergenic