ID: 1160566422

View in Genome Browser
Species Human (GRCh38)
Location 18:79788882-79788904
Sequence CGGAGCCCCGGTGGTTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160566412_1160566422 7 Left 1160566412 18:79788852-79788874 CCCGGCTCGGGGTCTCTGGGTTC No data
Right 1160566422 18:79788882-79788904 CGGAGCCCCGGTGGTTGGACAGG No data
1160566404_1160566422 28 Left 1160566404 18:79788831-79788853 CCCTGTGGGATGCTGTGTCGGCC No data
Right 1160566422 18:79788882-79788904 CGGAGCCCCGGTGGTTGGACAGG No data
1160566413_1160566422 6 Left 1160566413 18:79788853-79788875 CCGGCTCGGGGTCTCTGGGTTCT No data
Right 1160566422 18:79788882-79788904 CGGAGCCCCGGTGGTTGGACAGG No data
1160566405_1160566422 27 Left 1160566405 18:79788832-79788854 CCTGTGGGATGCTGTGTCGGCCC No data
Right 1160566422 18:79788882-79788904 CGGAGCCCCGGTGGTTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160566422 Original CRISPR CGGAGCCCCGGTGGTTGGAC AGG Intergenic
No off target data available for this crispr