ID: 1160567684

View in Genome Browser
Species Human (GRCh38)
Location 18:79797686-79797708
Sequence TGAGCGTGTGTGCCCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160567682_1160567684 5 Left 1160567682 18:79797658-79797680 CCGATGTGAGTGTGCACCTGTGT No data
Right 1160567684 18:79797686-79797708 TGAGCGTGTGTGCCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160567684 Original CRISPR TGAGCGTGTGTGCCCCTGCC AGG Intergenic
No off target data available for this crispr