ID: 1160568619

View in Genome Browser
Species Human (GRCh38)
Location 18:79801673-79801695
Sequence CCTTCAGGCTGATCTGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160568615_1160568619 -4 Left 1160568615 18:79801654-79801676 CCCAGTGTAGCTTCAGAAACCTT No data
Right 1160568619 18:79801673-79801695 CCTTCAGGCTGATCTGAATGTGG No data
1160568616_1160568619 -5 Left 1160568616 18:79801655-79801677 CCAGTGTAGCTTCAGAAACCTTC No data
Right 1160568619 18:79801673-79801695 CCTTCAGGCTGATCTGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160568619 Original CRISPR CCTTCAGGCTGATCTGAATG TGG Intergenic
No off target data available for this crispr