ID: 1160568881

View in Genome Browser
Species Human (GRCh38)
Location 18:79803300-79803322
Sequence CTGGAGGCCTAGAGGTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160568881_1160568888 -7 Left 1160568881 18:79803300-79803322 CCCCCTCACCTCTAGGCCTCCAG No data
Right 1160568888 18:79803316-79803338 CCTCCAGTTCTTCTTCCCGGAGG No data
1160568881_1160568886 -10 Left 1160568881 18:79803300-79803322 CCCCCTCACCTCTAGGCCTCCAG No data
Right 1160568886 18:79803313-79803335 AGGCCTCCAGTTCTTCTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160568881 Original CRISPR CTGGAGGCCTAGAGGTGAGG GGG (reversed) Intergenic
No off target data available for this crispr