ID: 1160568886

View in Genome Browser
Species Human (GRCh38)
Location 18:79803313-79803335
Sequence AGGCCTCCAGTTCTTCTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160568880_1160568886 -6 Left 1160568880 18:79803296-79803318 CCAGCCCCCTCACCTCTAGGCCT No data
Right 1160568886 18:79803313-79803335 AGGCCTCCAGTTCTTCTTCCCGG No data
1160568878_1160568886 16 Left 1160568878 18:79803274-79803296 CCTCTGTAGTCACAGGGCAGGGC No data
Right 1160568886 18:79803313-79803335 AGGCCTCCAGTTCTTCTTCCCGG No data
1160568872_1160568886 29 Left 1160568872 18:79803261-79803283 CCCAGCTCTTTCACCTCTGTAGT No data
Right 1160568886 18:79803313-79803335 AGGCCTCCAGTTCTTCTTCCCGG No data
1160568873_1160568886 28 Left 1160568873 18:79803262-79803284 CCAGCTCTTTCACCTCTGTAGTC No data
Right 1160568886 18:79803313-79803335 AGGCCTCCAGTTCTTCTTCCCGG No data
1160568871_1160568886 30 Left 1160568871 18:79803260-79803282 CCCCAGCTCTTTCACCTCTGTAG No data
Right 1160568886 18:79803313-79803335 AGGCCTCCAGTTCTTCTTCCCGG No data
1160568881_1160568886 -10 Left 1160568881 18:79803300-79803322 CCCCCTCACCTCTAGGCCTCCAG No data
Right 1160568886 18:79803313-79803335 AGGCCTCCAGTTCTTCTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160568886 Original CRISPR AGGCCTCCAGTTCTTCTTCC CGG Intergenic
No off target data available for this crispr