ID: 1160568888

View in Genome Browser
Species Human (GRCh38)
Location 18:79803316-79803338
Sequence CCTCCAGTTCTTCTTCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160568878_1160568888 19 Left 1160568878 18:79803274-79803296 CCTCTGTAGTCACAGGGCAGGGC No data
Right 1160568888 18:79803316-79803338 CCTCCAGTTCTTCTTCCCGGAGG No data
1160568884_1160568888 -10 Left 1160568884 18:79803303-79803325 CCTCACCTCTAGGCCTCCAGTTC No data
Right 1160568888 18:79803316-79803338 CCTCCAGTTCTTCTTCCCGGAGG No data
1160568882_1160568888 -8 Left 1160568882 18:79803301-79803323 CCCCTCACCTCTAGGCCTCCAGT No data
Right 1160568888 18:79803316-79803338 CCTCCAGTTCTTCTTCCCGGAGG No data
1160568880_1160568888 -3 Left 1160568880 18:79803296-79803318 CCAGCCCCCTCACCTCTAGGCCT No data
Right 1160568888 18:79803316-79803338 CCTCCAGTTCTTCTTCCCGGAGG No data
1160568881_1160568888 -7 Left 1160568881 18:79803300-79803322 CCCCCTCACCTCTAGGCCTCCAG No data
Right 1160568888 18:79803316-79803338 CCTCCAGTTCTTCTTCCCGGAGG No data
1160568883_1160568888 -9 Left 1160568883 18:79803302-79803324 CCCTCACCTCTAGGCCTCCAGTT No data
Right 1160568888 18:79803316-79803338 CCTCCAGTTCTTCTTCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160568888 Original CRISPR CCTCCAGTTCTTCTTCCCGG AGG Intergenic
No off target data available for this crispr