ID: 1160570051

View in Genome Browser
Species Human (GRCh38)
Location 18:79810002-79810024
Sequence GCTCCGCGAGGCTGGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160570051_1160570060 3 Left 1160570051 18:79810002-79810024 CCACAGGGCCAGCCTCGCGGAGC No data
Right 1160570060 18:79810028-79810050 CCGCCCATTGCGCTGGGCCTGGG No data
1160570051_1160570058 2 Left 1160570051 18:79810002-79810024 CCACAGGGCCAGCCTCGCGGAGC No data
Right 1160570058 18:79810027-79810049 CCCGCCCATTGCGCTGGGCCTGG No data
1160570051_1160570064 10 Left 1160570051 18:79810002-79810024 CCACAGGGCCAGCCTCGCGGAGC No data
Right 1160570064 18:79810035-79810057 TTGCGCTGGGCCTGGGTGGAAGG No data
1160570051_1160570065 11 Left 1160570051 18:79810002-79810024 CCACAGGGCCAGCCTCGCGGAGC No data
Right 1160570065 18:79810036-79810058 TGCGCTGGGCCTGGGTGGAAGGG No data
1160570051_1160570067 20 Left 1160570051 18:79810002-79810024 CCACAGGGCCAGCCTCGCGGAGC No data
Right 1160570067 18:79810045-79810067 CCTGGGTGGAAGGGCCGATGAGG No data
1160570051_1160570055 -3 Left 1160570051 18:79810002-79810024 CCACAGGGCCAGCCTCGCGGAGC No data
Right 1160570055 18:79810022-79810044 AGCCGCCCGCCCATTGCGCTGGG No data
1160570051_1160570054 -4 Left 1160570051 18:79810002-79810024 CCACAGGGCCAGCCTCGCGGAGC No data
Right 1160570054 18:79810021-79810043 GAGCCGCCCGCCCATTGCGCTGG No data
1160570051_1160570062 6 Left 1160570051 18:79810002-79810024 CCACAGGGCCAGCCTCGCGGAGC No data
Right 1160570062 18:79810031-79810053 CCCATTGCGCTGGGCCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160570051 Original CRISPR GCTCCGCGAGGCTGGCCCTG TGG (reversed) Intergenic