ID: 1160570263

View in Genome Browser
Species Human (GRCh38)
Location 18:79812064-79812086
Sequence CCAAATCTGGGAGGTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160570263_1160570272 22 Left 1160570263 18:79812064-79812086 CCCCCAAAACCTCCCAGATTTGG No data
Right 1160570272 18:79812109-79812131 TCAGGAAGCAGAAAGACAACAGG No data
1160570263_1160570271 4 Left 1160570263 18:79812064-79812086 CCCCCAAAACCTCCCAGATTTGG No data
Right 1160570271 18:79812091-79812113 AGACATAGATCTACAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160570263 Original CRISPR CCAAATCTGGGAGGTTTTGG GGG (reversed) Intergenic
No off target data available for this crispr