ID: 1160570700

View in Genome Browser
Species Human (GRCh38)
Location 18:79815820-79815842
Sequence ATCGGGGCACACAGGCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160570700_1160570715 18 Left 1160570700 18:79815820-79815842 CCCGCTGGCCTGTGTGCCCCGAT No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570700_1160570714 17 Left 1160570700 18:79815820-79815842 CCCGCTGGCCTGTGTGCCCCGAT No data
Right 1160570714 18:79815860-79815882 AGCTGAGCTGCACTGCCACAGGG No data
1160570700_1160570713 16 Left 1160570700 18:79815820-79815842 CCCGCTGGCCTGTGTGCCCCGAT No data
Right 1160570713 18:79815859-79815881 GAGCTGAGCTGCACTGCCACAGG No data
1160570700_1160570718 23 Left 1160570700 18:79815820-79815842 CCCGCTGGCCTGTGTGCCCCGAT No data
Right 1160570718 18:79815866-79815888 GCTGCACTGCCACAGGGGGGTGG No data
1160570700_1160570706 -6 Left 1160570700 18:79815820-79815842 CCCGCTGGCCTGTGTGCCCCGAT No data
Right 1160570706 18:79815837-79815859 CCCGATGGCACCCACCGCCCTGG No data
1160570700_1160570717 20 Left 1160570700 18:79815820-79815842 CCCGCTGGCCTGTGTGCCCCGAT No data
Right 1160570717 18:79815863-79815885 TGAGCTGCACTGCCACAGGGGGG No data
1160570700_1160570716 19 Left 1160570700 18:79815820-79815842 CCCGCTGGCCTGTGTGCCCCGAT No data
Right 1160570716 18:79815862-79815884 CTGAGCTGCACTGCCACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160570700 Original CRISPR ATCGGGGCACACAGGCCAGC GGG (reversed) Intergenic
No off target data available for this crispr