ID: 1160570704

View in Genome Browser
Species Human (GRCh38)
Location 18:79815836-79815858
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160570704_1160570715 2 Left 1160570704 18:79815836-79815858 CCCCGATGGCACCCACCGCCCTG No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570704_1160570714 1 Left 1160570704 18:79815836-79815858 CCCCGATGGCACCCACCGCCCTG No data
Right 1160570714 18:79815860-79815882 AGCTGAGCTGCACTGCCACAGGG No data
1160570704_1160570718 7 Left 1160570704 18:79815836-79815858 CCCCGATGGCACCCACCGCCCTG No data
Right 1160570718 18:79815866-79815888 GCTGCACTGCCACAGGGGGGTGG No data
1160570704_1160570716 3 Left 1160570704 18:79815836-79815858 CCCCGATGGCACCCACCGCCCTG No data
Right 1160570716 18:79815862-79815884 CTGAGCTGCACTGCCACAGGGGG No data
1160570704_1160570713 0 Left 1160570704 18:79815836-79815858 CCCCGATGGCACCCACCGCCCTG No data
Right 1160570713 18:79815859-79815881 GAGCTGAGCTGCACTGCCACAGG No data
1160570704_1160570717 4 Left 1160570704 18:79815836-79815858 CCCCGATGGCACCCACCGCCCTG No data
Right 1160570717 18:79815863-79815885 TGAGCTGCACTGCCACAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160570704 Original CRISPR CAGGGCGGTGGGTGCCATCG GGG (reversed) Intergenic
No off target data available for this crispr